Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MST28
Systematic Name YAR033W
Strain S288c
Description Putative integral membrane protein, involved in vesicle formation; forms complex with Mst27p; member of DUP240 gene family; binds COPI and COPII vesicles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MST28 YAR033W
TTCCCAAGGACATATTCGGTTCGTACTTAAGTTATTGGATATATGAAGTTACTCGTCATA
AAGCGGCAGTAATTTTGCTCGTACTTATTGTGACTTCAATTTTATTATTAGTGTTTTTTT
ATAATACGGAATTTTGCGTTGCCTTTGAGATACTATTGTTTTCCTTTTGCTTTCCAGGAA
CATGCATGGTTGTAATTGCATTTAGTGAACCGATCGGTGATCGGGAATTTAAAGTTAAGC
TTCTGATGGAAATTATCACACGTAAACCGGCGGTAAAGGGGAAAGAATGGAGGACAATTA
CATACAAGATGAACCAGTATTTATTTGATCATGGGCTATGGGATACTCCCTACTACTTTT
ACCGTGATGAAGATTGCCACCGTTATTTTCTAAGTCTTATTAAGGGAAGAACTTTCAAGA
AGCAAAAGGAATCGTCAGCCAGCAATGTTAAAGACGCACAATCAAATGACGAAACCGCTG
GCACACCAAACGAAGCCGCTGAGTCTTCTAGTTTTAGTGCCGGACCGAACTTTATAAAGC
TCCTCACCAAGGCAGCCGAAATCGAACAACAATTTCAAAAGGAATATTGGCGACAAGAGT
ATCCTGGTGTCGATGAGTTTTTTTAGACAGAAGACGGGAGACACTAGCACACAACTTTAC
CAGGCAAGGTATTTGACGCTAGCATGTGTCCAATTCAGTGTCATTTATGATTTTTTGTAG
TAGGATATAAATATATACAGCGCTCCAAATAGTGCGGTTGCCCCAAAAACACCACGGAAC
CTCATCTGTTCTCGTACTTTGTTGTGACAAAGTAGCTCACTGCCTTATTATCACATTTTC
ATTATGCAACGCTTCGGAAAATACGATGTTGAAAATGCCTCTAGAGATGAAAAACAATCG
TAAAAGGGTCCTGCGTAATTGAAACATTTGATCAGTATGCAGTGGCACAGAAACAACCAG
GAATACTATAGTCATAGGCAATACAAGGTATATATTGGCT
Chr coordinates Chr I from 188107-188811
w3c xhtml validator w3c css validator