Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FLO1
Systematic Name YAR050W
Alias FLO2, FLO4
Strain S288c
Description Lectin-like protein involved in flocculation, cell wall protein that binds to mannose chains on the surface of other cells, confers floc-forming ability that is chymotrypsin sensitive and heat resistant; similar to Flo5p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FLO1 YAR050W
AAAAAAGTGCATTTATTTAGGTAAGTCTCATTACCTAAACGCCAGTTTGTTTCACGTAAT
TGGTAACGATGAGGGAACCGCAGTAGAAAAAACTTTCATTCACAAACGATTAAAGTGTTA
TGCTAGCCAGTTTCAGGCTTTTTGTTTTATGCAAGAGAACATTCGACTAGATGTCCAGTT
AAGTGTGCGTCACTTTTCCTACGGTGCCTCGCACATGAATGTTATCCGGCGCACGATACT
TATCACCGAAAAACCTTATTCTACGGAAAACCTTATTTACATTAAAGTTGGAAAAATTTC
CTCTTTTTCCTAATAAGGTGGAGCTTTTGGCTTCCAGTATGCTTTCACGGAATTATTTCT
CATGTACATTTAGCTCCATTTCCAGTGCCTCCGATAGGGAGGCATCATGGTACTACCGTG
ACGGAGAATACGTAGGCTGACTTTTTCGTCAGTTTGTTGTCCGTTTACAAAATTGGTGAA
TGAATTCTAGCCTTCCTCTGCTCATTAATTGCCCTCACAAGAATTTGGAAGTGCGTAGAA
CAGGTAAAAGATTGTACTACAGAGGTATTGTGGAACCTTCTACAGTACTTCGGAATACAC
CTAAAAGGTTGTTGGATGCTAAATTTAGCAAAAGTCTTTTTTAGCTCACTATTAGGCTTG
TTAAAGTCTGAAATTGTTGAAAGGCACTCAAAAAGATAAATCAACAATCAGCATTAACGG
CACAGTTGAAAGAGTCACCCACTTGAAATTAGCTCGGTTATCAAATATAATTATCTCTGG
TAAAGAGCTCTGCAGCAGGGTTAATCTATTCGCATACTTACGCTGTAGGAACATTTTATT
ATTAGGATCCGACTACTGCCTACATATTTATTCGGAAGGCATGATGTCGAAAATTTTTGA
GCTTATAAAAGGAACATATTTCACTCTTGCTCGTTTGATGTAAGCTCTCTTCCGGGTTCT
TATTTTTAATTCTTGTCACCAGTAAACAGAACATCCAAAA
Chr coordinates Chr I from 203403-208016
w3c xhtml validator w3c css validator