Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR064W
Systematic Name YAR064W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YAR064W YAR064W
ATGTTGATTGATTTTTGCTGTAGTTATATAGCAGGGACCCACGGAAGAGAGCGAGCGCCT
TCTTTCACAGGGACTTTTGTCAGCCACGTCTCCGGGGAAAACAATTGCCGTCCGCGTCGC
AGTGAGATTACGCAGCCGTGCGCTTCAGGGACAGAAAAGAAGCATTTCGCGGCTACGGAG
AAACCGTGCACTAACTCTCTCGAGGGTAGCCGCAAAGATTTCTTGTCTCTTCCATTAGGA
CATAGCTATCTTTTTCTTTTCTGTTTTTGGCGTATGATCTGTTCTGAGCCAAAGTTATAG
Promoter Sequence
Download FASTA
>YAR064W YAR064W
CCTCAGTCATGTCTTCCTCGGTCATTTCTTCTTCTGCAACGACCTCCACTTCTATATTCT
CTGAATCATCTAAATCATCCGTCATTCAAACCAGTAGTTCCACCTCTGGTTCTTCTGAGA
GCGAAACAATCTTAGTGATTGCTGGCATGTCATTAGCGACAAGACGCTTATTACCGTAGT
AGCCCCCCAAGGCAAACATCTCTTTATCAGTAATATCCAAAGCTGTTCAACTTCTCGAAT
TGGCCCAGGAAAAGAGCATTGGGGCGGCAACTAACTCTGGCATACTTACAGTTTCTGCTC
TTGACAGCGCTAAAAAAGGGCTTGTTTTGTAATGCCCGGTTCGCAATTCTACAAGTACCA
CGCACTAGCTGCTAAAAGTGTCTAACCTTGCGAACAAATCTGGACTTTCTTATGAGAATC
CCATCGTCAAGAAACAAAATTATACAGACAGGCGTAAATGTAGCTCGTAAGCGCCTGATC
AAGTAAGCCAAATGCGCTAACTTGAGGAAATATAGCCATCTAAATCTCTGCAACATGCCA
ATTCGCACGTGACTTGAAACTATGGAAAGTGTCTAGAAGATTACCAAGAACCACGTTATT
TGAGAGAGGATGGCAAGGTGACGACAATCACACCAAGACCACATTTTGGGTGCGCCTGGA
AGCAAGACCTGAGAAACTGGGCCAAAATATTCAAACCAAGCATAAGATAGTTGGAGGTAG
GAATACACTATCTAATCTGTGCTGATGAAATGCTGGCGAAAACGGGCGATGTAGTGGTAC
AGAAGGTGCCGGTTATCCGTTTGTCCGTTTTTCTTCATTTTTTTTTTGTTTTTCCCTTTT
GTCTTTTGCACCGCTTATATATGGGTATGAAACAAGTTCAAGAATTTATAATGGAACCCA
AAGGTTCAGTCTTTGTAGTTCGAGCGACATTGCGCGTTTCCTTAGAAAACGCTGGAAAGA
TATTCTTTAACGAGACGGAGTAATTCTCGTCAGGAATAGG
Chr coordinates Chr I from 220198-220497
w3c xhtml validator w3c css validator