Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR066W
Systematic Name YAR066W
Strain S288c
Description Putative GPI protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR066W YAR066W
CGCTTATATATGGGTATGAAACAAGTTCAAGAATTTATAATGGAACCCAAAGGTTCAGTC
TTTGTAGTTCGAGCGACATTGCGCGTTTCCTTAGAAAACGCTGGAAAGATATTCTTTAAC
GAGACGGAGTAATTCTCGTCAGGAATAGGATGTTGATTGATTTTTGCTGTAGTTATATAG
CAGGGACCCACGGAAGAGAGCGAGCGCCTTCTTTCACAGGGACTTTTGTCAGCCACGTCT
CCGGGGAAAACAATTGCCGTCCGCGTCGCAGTGAGATTACGCAGCCGTGCGCTTCAGGGA
CAGAAAAGAAGCATTTCGCGGCTACGGAGAAACCGTGCACTAACTCTCTCGAGGGTAGCC
GCAAAGATTTCTTGTCTCTTCCATTAGGACATAGCTATCTTTTTCTTTTCTGTTTTTGGC
GTATGATCTGTTCTGAGCCAAAGTTATAGATCATTGCTTGAATAAGCACCTCACAGAGTA
GGGATTGTATAGAAAGTAGCTGAGCGTCTGCCCACGTAACAAACAATCTTGCCCCTTCCC
CGCTCTTGTTTTCGCGTGCCTCTTCTACAATAATCTGGCCAGGCTGAATCGCGTTCTGCT
GCTGCTGCTGCTATTGTTATTGTTGTTGTTGTTGTTTTGGCCAATTGCTTATGTGTTGGT
CTGCAAATTAGCACCTCGTTCCCTGTTGGCAAACGCGCGCGTACAAGCCTTACAGGGCTT
GAGAATGTTCTTCGTAGAAATGCATGCACAAAAATTCTGATCTAGCACACCATCGGTCTC
TGTAGCTTCGGGCTCTATAGCTATGGGTTAGGAGTCCGTGAGTAGTAACAAGAAGAAGTA
TATAAAAAGCAGGTAAATCGTACTTCAATATGCTTCATTGTCACTGGATCGTCATATTCA
CTCTTGTTCTCATAATAGCAGTCCAAGTTTTCATCTTTGCAAGCTTTACTATTTCTTTCT
TTTTATTGGTAAACTCTCGCCCATTACAAAAAAAAAAGAG
Chr coordinates Chr I from 221049-221660
w3c xhtml validator w3c css validator