Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR066W
Systematic Name YAR066W
Strain S288c
Description Putative GPI protein
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YAR066W YAR066W
ATGTTCAATCGTTTTAACAAATTCCAAGCTGCTGTCGCTTTGGCCCTACTCTCTCGCGGC
GCTCTCGGTGACTCTTACACCAATAGCACCTCCTCCGCAGACTTGAGTTCTATCACTTCC
GTCTCGTCAGCTAGTGCAAGTGCCACCGCTTCCGACTCACTTTCTTCCAGTGACGGTACC
GTTTATTTGCCATCCACAACAATTAGCGGTGATCTCACAGTTACTGGTAAAGTAATTGCA
ACCGAGGCCGTGGAAGTCGCTGCCGGTGGTAAGTTGACTTTACTTGACGGTGAAAAATAC
GTCTTCTCATCTGATCTAAAAGTTCACGGTGATTTGGTTGTCGAAAAGTCTGAAGCAAGC
TACGAAGGTACCGCGTTCGACGTTTCTGGTGAGACTTTTGAAGTTTCCGGTAACTTCAGT
GCTGAAGAAACTGGCGCTGTCTCCGCATCTATCTATTCATTCACACCTAGCTCGTTCAAG
AGCAGCGGTGACATTTCTTTGAGTTTGTCAAAGGCCAAGAAGGGTGAAGTCACCTTTTCT
CCATACTCTAACGCTGGTACCTTTTCTTTGTCAAATGCTATTCTCAACGGTGGTTCTGTT
TCCGGTTTGTAA
Promoter Sequence
Download FASTA
>YAR066W YAR066W
CGCTTATATATGGGTATGAAACAAGTTCAAGAATTTATAATGGAACCCAAAGGTTCAGTC
TTTGTAGTTCGAGCGACATTGCGCGTTTCCTTAGAAAACGCTGGAAAGATATTCTTTAAC
GAGACGGAGTAATTCTCGTCAGGAATAGGATGTTGATTGATTTTTGCTGTAGTTATATAG
CAGGGACCCACGGAAGAGAGCGAGCGCCTTCTTTCACAGGGACTTTTGTCAGCCACGTCT
CCGGGGAAAACAATTGCCGTCCGCGTCGCAGTGAGATTACGCAGCCGTGCGCTTCAGGGA
CAGAAAAGAAGCATTTCGCGGCTACGGAGAAACCGTGCACTAACTCTCTCGAGGGTAGCC
GCAAAGATTTCTTGTCTCTTCCATTAGGACATAGCTATCTTTTTCTTTTCTGTTTTTGGC
GTATGATCTGTTCTGAGCCAAAGTTATAGATCATTGCTTGAATAAGCACCTCACAGAGTA
GGGATTGTATAGAAAGTAGCTGAGCGTCTGCCCACGTAACAAACAATCTTGCCCCTTCCC
CGCTCTTGTTTTCGCGTGCCTCTTCTACAATAATCTGGCCAGGCTGAATCGCGTTCTGCT
GCTGCTGCTGCTATTGTTATTGTTGTTGTTGTTGTTTTGGCCAATTGCTTATGTGTTGGT
CTGCAAATTAGCACCTCGTTCCCTGTTGGCAAACGCGCGCGTACAAGCCTTACAGGGCTT
GAGAATGTTCTTCGTAGAAATGCATGCACAAAAATTCTGATCTAGCACACCATCGGTCTC
TGTAGCTTCGGGCTCTATAGCTATGGGTTAGGAGTCCGTGAGTAGTAACAAGAAGAAGTA
TATAAAAAGCAGGTAAATCGTACTTCAATATGCTTCATTGTCACTGGATCGTCATATTCA
CTCTTGTTCTCATAATAGCAGTCCAAGTTTTCATCTTTGCAAGCTTTACTATTTCTTTCT
TTTTATTGGTAAACTCTCGCCCATTACAAAAAAAAAAGAG
Chr coordinates Chr I from 221049-221660
w3c xhtml validator w3c css validator