Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR068W
Systematic Name YAR068W
Strain S288c
Description Fungal-specific protein of unknown function; induced in respiratory-deficient cells
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR068W YAR068W
AGCTACGAAGGTACCGCGTTCGACGTTTCTGGTGAGACTTTTGAAGTTTCCGGTAACTTC
AGTGCTGAAGAAACTGGCGCTGTCTCCGCATCTATCTATTCATTCACACCTAGCTCGTTC
AAGAGCAGCGGTGACATTTCTTTGAGTTTGTCAAAGGCCAAGAAGGGTGAAGTCACCTTT
TCTCCATACTCTAACGCTGGTACCTTTTCTTTGTCAAATGCTATTCTCAACGGTGGTTCT
GTTTCCGGTTTGTAACGTAGAGACGACGATGAAGGCTCTGTAAATAACGGTGAAATCAAC
CTAGACAATGGAAGTACCTATGTTATCGTTGAACCAGTTTCTGGAAACGGTACAATCAAC
ATCGTCTCTGGTAACCTATACTTGCACTACCCTGACACCTTTACTGGCCAAACTGTTGTA
TTCAAGGGTGAAGGTGTTCTTGCCGTTGACCCAACCGAAACCAACGCCACTCCTATTCCT
GTTGTTGGCTACACCGGTAAGAACCAAATTGCCATTACCGCCGACATCACTGCTCTTTCT
TACGACGGTACTACTGGTGTCTTAACTGCAACCCAAGGTAACAGACAATTCTCTTTTGAA
ATTGGTACTGGATTCTCTAGTTCTGGCTTCAGTGTCTCCGAAGGAATCTTCGCAGGCGCC
TACTCATATTACCTAAACTATGACGGTGTCATCGCTACAAGCGCCGCATCCACATCCGCA
TCCACTACCTCTGGTGTTGTCTCTACTGCCACTGGTTCAGTCACTTTATCCTCTAACGCT
TCTACCACCGTCTCTTCTACGATCTCTTCTAGCGCCCCAGACTCAATAATTCCTTCATCT
AGCGCCTCTATCTCTGGTGTCTCAAACTCCACTACAGCATCTGGTTCAATCGCTTCTACT
GCTTCCACCGCTTCCACTACTTCTACTGCATCCGCTGCATCCGCCACCAGCTTCACCTCA
GGTTCCGCTTCTGTCTACACTACTACATTAACTTACTTGA
Chr coordinates Chr I from 222406-222891
w3c xhtml validator w3c css validator