Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO11
Systematic Name YAR071W
Strain S288c
Description One of three repressible acid phosphatases, a glycoprotein that is transported to the cell surface by the secretory pathway; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO11 YAR071W
GGTGCTGTGACCGTTTCCAATACGGAAAGAAACGGTACTGGGAGCAGGAGTTGCTTTTAC
AGATATGAACAATGCCAATAGAGCCGCACATGTAATTACTGGTTCACACTCGTGGGGCCC
ACACGATTCCTGTGCAAAGTTTGACAAGAGGATGGAGTTTCACGTAAATGCTGCCAAAGG
TGATGCGGTTTTGTTTTTGGGCAGCCTCTACCATGTTGCAAGTGCGAACCATACTGTGGC
CACATAGATTACAAAAAAAGTCCAGGATATCTTGCAAACCTAGCTTGTTTTGTAAACGAC
ATTGAAAAAAGCGTATTAAGGTGAAACAATCAAGATTATCTATGCCGATGAAAAATGAAA
GGTATGATTTCTGCCACAAATATATAGTAGTTATTTTATACATCAAGATGAGAAAATAAA
GGGATTTTTTCGTTCTTTTATCATTTTCTCTTTCTCACTTCCGACTACTTCTTATATCTA
CTTTCATCGTTTCATTCATCGTGGGTGTCTAATAAAGTTTTAATGACAGAGATAACCTTG
ATAAGCTTTTTCTTATACGCTGTGTCACGTATTTATTAAATTACCACGTTTTCGCATAAC
ATTCTGTAGTTCATGTGTACTAAAAAAAAAAAAAAAAAAGAAATAGGAAGGAAAGAGTAA
AAAGTTAATAGAAAACAGAACACATCCCTAAACGAAGCCGCACAATCTTGGCGTTCACAC
GTGGGTTTAAAAAGGCAAATTACACAGAATTTCAGACCCTGTTTACCGGAGAGATTCCAT
ATTCCGCACGTCACATTGCCAAATTGGTCATCTCACCAGATATGTTATACCCGTTTTGGA
ATGAGCATAAACAGCGTCGAATTGCCAAGTAAAACGTATATAAGCTCTTACATTTCGATA
GATTCAAGCTCAGTTTCGCCTTGGTTGTAAAGTAGGAAGAAGAAGAAGAAGAAGAGGAAC
AACAACAGCAAAGAGAGCAAGAACATCATCAGAAATACCA
Chr coordinates Chr I from 225460-226863
w3c xhtml validator w3c css validator