Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IMD1
Systematic Name YAR073W
Strain S288c
Description Nonfunctional protein with homology to IMP dehydrogenase; probable pseudogene, located close to the telomere; is not expressed at detectable levels; YAR073W and YAR075W comprise a continuous reading frame in some strains of S. cerevisiae
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IMD1	6319352 upstream sequence, from -1000 to -1, size 1000
GAGTAGCCGGTACTGACTTCCTAAAGGTCTGTAACGTCAGCAGCGTCAGTAACTCTACTG
AATTGACCTTTTTCTGGGACTGGAATACCAAGCACTACAACGACACTTTATTAAAACAGT
AAATAGATAATATGATTATGTAATTTTAGAAACTAATTATGAATACCGATTTATTTTTTT
TTTTTTTTTTCACTTTTGCTGGCAAGAAATACGAAATTGCAATGACGATCACAGTCCAAA
GAGGTAAGCACAAAGGCGCAGTATGTGATTACTCTATCATTCTTTAGCAAAACCAGGATA
GGAGTATATGTATAAGAAATATGCAACGCCATCATTTAATGCAATAGACACGACATGCCC
TTTACATGAGGTGGTACAATGTTTTAATATTGTGTCAGGGCAAGTACATGATAATATCGT
TTAAAGATGATGCTAGAGTAAAAGTATGAAGTGAAAGAAAAGGGCAATTGATTGACTAAG
CGGATGTTGTAGGATGATATAGTGGCTCATGATCTGTAAATGATCGGTTGACCGCAGTAT
TATATAATAACATCCGTATAAGTACATATACTACCATGTCTGTTCTCTACATTGCTTTTT
ATTCAAGATTATTGGTTTTCCTAACCGCCGCGCCGCGCAGGTACCCCGCGCATCTCTTCT
TCTCGAAGAAAGCGGAAAAAACAAAAAAAAAAGTATAAATAGTGGAGTCTTTTCCCATTT
AACATTTAGAAAAAAATTCGAATGGAAATTTCTTGCCGAACATTTAACCGGAGACCCTTG
GCGGCTTTTTCTCAGTTTCGTGGGCTAGTACATTTTACCTAGTATGCTGGGAACTTTTTT
TCCGTATTCTATTCTATTCCTTGCCTTACTTTTCTTATCATTTTTTATATAACCAATTTC
AAAAATACTTTTTAACTGTCATAGACGCATTTTGTTTATTACAAATTAAAAGAATCAAAT
ATAATATGTGCAATTAATAACTCCACAAGTAGCGAAAGCA
Chr coordinates
w3c xhtml validator w3c css validator