Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HTB2
Systematic Name YBL002W
Strain S288c
Description Histone H2B; core histone protein required for chromatin assembly and chromosome function; nearly identical to HTB1; Rad6p-Bre1p-Lge1p mediated ubiquitination regulates reassembly after DNA replication, transcriptional activation, meiotic DSB formation and H3 methylation
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HTB2 YBL002W
TACCCAATAGCTTGTTCAATTCATCATCATTTCTGATGGCCAATTGTAAATGTCTTGGAA
TAATTCTGGTTTTTTTGTTATCTCTAGCAGCATTACCAGCCAATTCTAAAATTTCAGCAG
CCAAATATTCTAAGACAGCAGTTAGATAGACTGGAGCACCAGAACCAATTCTCTGGGCGT
AGTTACCTCTTCTTAGCAATCTGTGCACTCTACCAACTGGGAATGTTAAACCAGCTTTAG
CAGATCTAGATTGAGAAGCTTTAGCAGCTGAACCAGCTTTACCACCTTTACCACCGGACA
TTATATATTAAATTTGCTCTTGTTCTGTACTTTCCTAATTCTTATGTAAAAAGACAAGAA
TTTATGATACTATTTAATAACAAAAAACTACCTAAGAAAAGCATCATGCAGTCGAAATTG
AAATCGAAAAGTAAAACTTTAACGGAACATGTTTGAAATTCTAAGAAAGCATACATCTTC
ATCCCTTATATATAGAGTTATGTTTGATATTAGTAGTCATGTTGTAATCTCTGGCCTAAG
TATACGTAACGAAAATGGTAGCACGTCGCGTTTATGGCCCCCAGGTTAATGTGTTCTCTG
AAATTCGCATCACTTTGAGAAATAATGGGAACACCTTACGCGTGAGCTGTGCCCACCGCT
TCGCCTAATAAAGCGGTGTTCTCAAAATTTCTCCCCGTTTTCAGGATCACGAGCGCCATC
TAGTTCTGGTAAAATCGCGCTTACAAGAACAAAGAAAAGAAACATCGCGTAATGCAACAG
TGAGACACTTGCCGTCATATATAAGGTTTTGGATCAGTAACCGTTATTTGAGCATAACAC
AGGTTTTTAAATATATTATTATATATCATGGTATATGTGTAAAATTTTTTTGCTGACTGG
TTTTGTTTATTTATTTAGCTTTTTAAAAATTTTACTTTCTTCTTGTTAATTTTTTCTGAT
TGCTCTATACTCAAACCAACAACAACTTACTCTACAACTA
Chr coordinates Chr II from 236492-236887
w3c xhtml validator w3c css validator