Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HIR1
Systematic Name YBL008W
Strain S288c
Description Subunit of the HIR complex; HIR is a nucleosome assembly complex involved in regulation of histone gene transcription; contributes to nucleosome formation, heterochromatic gene silencing, and formation of functional kinetochores
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HIR1 YBL008W
TATTTTTCAAATACCAGGGAACTCCTCTATCAAGGTGCTCTAACATTGATTACTCTCAAG
CATTGTCTATTTTCTGGCAGTGCAGCAGTATTTTATATGTTGCTGAATCCAAATTTCAGC
TCGAACACAGGAATCTAACTTTGGACCATATTTTGATAGACTCTAAAGGGAATGTTACTT
TAATTGATATGAAGTGCTGTCGTTTCTTGAATATAGACAACAATAAGGCTTCCTATACAA
GATTAGACCATCATTATTTCTTCCAAGGCCGGGGGACTCTTCAATTCGAGATATATGAAC
TGATGAGAAGCATGCTGCCTCAGCCAATATCCTGGGCTACATTTGAACCAAGAACAAACC
TATTATGGTTATATCACCTAAGTAGCAGCCTGCTAAAAATGGCCAAAAAAGCCGTAGTCA
GCGGCGCTTTGAACCGGGAAGAAAATATCTTAATCGAGTTGACGCACTTACTCGATCCTG
CTCGAAAACATTCCAAAACAATTTTCAAAAAGGAACTTGTTATAAGAACTTGCGGTGATT
TGTTATCTTTGAAGGGAGAAATAATGCAGTAAAGACATCGTAGTAATAAGGTGCAAGCTT
TTGTATCCTTCTTAATGATTTGTAAGCAAAAAAAAATTACGTACATCAATTTGTAATGGA
AAGGAAATAAATAGTATAATATGAACACTCTTTCTGAGAACAGTTATCTTTAGCTTGCCC
CACAAACTGAAAGCACATTTTTAAAATGTTTTACAGATGAAAATGAACCCTTGTACTGTT
ATCCTCTGTAAGTCGTTATTTTTCTTTTGCCTTTTTCAGGTTGACTGCTACTGTAATCGT
AAGAATATTCAAAATCAATCATCTCGCATCGCAACAAAAATAAAACGAAGTTACTGGTTT
AGGTGGCAGAAACATATAATATTGGCGAACATTCATAAAATAATTAAGGCTTACCAACGA
AGCATAATAAAATTGCCAGTAACCAAAGGTCTCTGATAAC
Chr coordinates Chr II from 209653-212175
w3c xhtml validator w3c css validator