Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ACH1
Systematic Name YBL015W
Strain S288c
Description Protein with CoA transferase activity, particularly for CoASH transfer from succinyl-CoA to acetate; has minor acetyl-CoA-hydrolase activity; phosphorylated; required for acetate utilization and for diploid pseudohyphal growth
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ACH1 YBL015W
TGGCAGAGATTATCGCCATCAACTACTACTGATATTCGGTATCATCGGTACACCTCACTC
AGATAATGATTTGCGGTGTATAGAGTCACCCAGGGCTAGAGAGTACATAAAGTCGCTTCC
CATGTACCCTGCCGCGCCACTGGAGAAGATGTTCCCTCGAGTCAACCCGAAAGGCATAGA
TCTTTTACAGCGTATGCTTGTTTTTGACCCTGCGAAGAGGATTACTGCTAAGGAGGCACT
GGAGCATCCGTATTTGCAAACATACCACGATCCAAACGACGAACCTGAAGGCGAACCCAT
CCCACCCAGCTTCTTCGAGTTTGATCACTACAAGGAGGCACTAACGACGAAAGACCTCAA
GAAACTCATTTGGAACGAAATATTTAGTTAGCCATCATTATCATTAAAATATCAACCCGA
AGAACAATGTATACATATACATATACGTACACATATACATATGTACATATGACATACGTA
TTAGCCGCTGAGGACGCGGACGTATAAAAGGACAATACTTATATGGAGCTAAGGGGAGCA
GTTACGCAACTCCGTGATCGCGCGCCACGGGCCGTCGGCGGCTGTTAATTGAAGAAAAAA
AAAATGAAGAACCACAAGGGGTGATCCATATAGGTGACTAGCATCATCCCCTGCGACGCG
CGGCCCGCCGGGCCAAAGGCGGGCAATGCGCGCTGCTGATTGGCCTCGAGGACAACGCCC
TCAACCACATCCGCAACAGCCAATCCCATCGGAGCGTCAAACTACCAAAGTAGTGATTGT
ATGGATGACCACTGTATTGTGGACGGTAAGCGCTTGCTGGAGCAAATGTGTAATCAAGTT
GCTGTGTATATATAGACGTTAGATGTGTTCTACCCCTTCTTTTGTCTTGTGCCCACCGGG
CTTACATTAGCACACAAAGCAGCAAGAGACCGTCTTACTAGACAATAGCGGCAAAACAAA
CAACACATTTCTTTTTTTCTTTTTCACATATTGCACTAAA
Chr coordinates Chr II from 194122-195702
w3c xhtml validator w3c css validator