Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name POP8
Systematic Name YBL018C
Strain S288c
Description Subunit of both RNase MRP and nuclear RNase P; RNase MRP cleaves pre-rRNA, while nuclear RNase P cleaves tRNA precursors to generate mature 5' ends and facilitates turnover of nuclear RNAs
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>POP8 YBL018C
TGCTCCCTCATCACCACATGCTTGCCCAGGAAAAGAAAAAGAATTCAAGGAAAAGTACTC
AGTAAGTGCCGGTCCCTTTGCATTTATTTTCATTTCAATTCTTTTAATAATTTTCTTTGC
CGCATGGTTTGTATATGACAGAGGTATCAGAAGAAATGGGGGATTTGCAAGGTTTGGAGA
AATTAGGCTAGGTGACGATGGTTTAATAGAAAACAATAATACTGACAGAGTTGTCAATAA
CATTGTGAAATCAGGATTTTACGTTTTCTCAAATATCGGGTCTCTTTTACAGCACACAAA
AACTAATATAGCGCATGCTATCTCCAAAATTAGAGGAAGGTTTGGAAACAGAACAGGTCC
AAGCTACTCATCCCTGATCCATGATCAATTTTTGGATGAAGCAGATGACCTGCTTGCTGG
CCACGATGAAGACGCCAATGACTTATCCAGTTTCATGGATCAGGGTAGTAATTTTGAAAT
CGAAGAAGATGATGTTCCAACACTTGAAGAAGAGCATACATCATATACAGATCAACCTAC
GACCACCGATGTTCCAGATACATTACCAGAAGGAAATGAGGAAAACATCGACAGGCCTGA
TTCTACAGCGCCATCTAACGAAAACCAGTAGAGAGATTACTTTACATAGAGTAGATAATT
CCATATACTTTTCATAAACAAAAACGAGCAGATCCTTTAGACAGAATATCAAGTTCTTTC
ACAAGCCAAAGAAACTTGGCATGATCAGTACTGGTGCAATTCAAATAACTGCAAGTACTG
AATCTCCATCTTCAAAGCAGAACCGTAATAATGCGTACAAGGAAGCGGGTGGGATATATC
ATATGTTACGGGAAAGTGGTTGTTTGACTGAAGATCATCGAGAACGTCATAACTTCAATA
CATAAGTCATCGCGTAATTTTACAAGCTTTACTGTTCAGCTTTATAGGATAATCAGAATA
AGAAAAGGCAGATAAATAGTTTGATAAATGGCCAGTTGTG
Chr coordinates Chr II from 186352-185998,186474-186428
w3c xhtml validator w3c css validator