Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HAP3
Systematic Name YBL021C
Strain S288c
Description Subunit of the Hap2p/3p/4p/5p CCAAT-binding complex; complex is heme-activated and glucose-repressed; complex is a transcriptional activator and global regulator of respiratory gene expression; contains sequences contributing to both complex assembly and DNA binding
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HAP3 YBL021C
GTGCTAACTTTCCCAAGGCAAATGCCAATATGGCGATGCCTTCTTTGTCAATGTCCGATG
TGACAACCCCCATTGGGTAGCGGGATTGCTGAACGGCATAAACAACTATAAAATTGACAA
TACATCCTGTAGTCACCGCGATGCTTTCAAATCTTGACCTTGCGGCATAGTTCAACATAA
ACTGGTTGACGATGAAGAATGGCTCGCTTAACAGCTCCACGATGATACTCAGCCAGATAA
GAAAAATCGACCACCTGAAGAATGGAAGAGTGATGAAATACGCGTTGATGTTTCTGTACT
GCCAGGCGATAAGACCAATGGACAGTGGAAACCCGATCCAAAACGGAATGTAAGCAAAAT
TGACTGCGGTTTGCAAAACTTTAGACTTGTAATGAGTTTCCTGGTACTCCTCCTCGTCGT
CATCATCGATTATTCCATTACCGGAGTCTGAGATTCTCAACGTCGACAGACGAATCGCAT
CTCTGCTAAAAAATAACACTGTGCCCTGTATAAATTCTAGAAAGGCCGTGATACCGAAAA
TTCTGGGCGACAGAAACCTGATCAACAAATTATTTAGTATGAACGTTACCAGTTTGGTGA
AAAGTTGGCCCATCATGAGGAAGGTAGCTCCTGTTGTGGACCTTTCCAAGATCTGCTCAC
TAGTAGAGGGCAATTGTGAGTTTTTTTTCGCCATTTTTTCTTTTCCTTCACTGACAAAAG
CAGAATCAACTTCAAATCACCCTATCTGTGGCCCTTTACTGCTACTAATACGCATTGTCT
TCTCCAGGCTGCGATTACTGCAAACCTTCTGCCAAAATATAGCACAATAGAAGTACCATA
TTACGTTCGATGCCACGACAATATCGCGCTACGTGCGTTTTTTGGTCCGCTCTTTCAGAC
TAAGTAAAAAAAGAGCTGCGAATAGTAGCTTTCCGCCAATCAAACTCAAGAGCAGGACTA
AGCTAGATAGTAACACAAGTGGCACAAACCTCTCGAGAAT
Chr coordinates Chr II from 182094-181660
w3c xhtml validator w3c css validator