Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBL029C-A
Systematic Name YBL029C-A
Strain S288c
Description Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cell periphery; has potential orthologs in Saccharomyces species and in Yarrowia lipolytica
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBL029C-A YBL029C-A
CGTATTAAGATTGTGTTTATTTTTATGCAGGAAGGGGAATCGCACAGATAGTCAATAACC
AACTGGCCGACTAACTGCATAAGAAATCGTTGTTTTTTTTTTCGAAGGCTCATTCAGATA
AAGAAATCACTACGCGTTTTGTCTGTGAAGTCACAGATTTGAAAAATGAGAACGAAAAAC
ATAACCACCTATGAGATTGAGTCCCTACATTTTACCATTTACGCTACTAAGTTACCCAAT
ATCGTAACACGAAATAACAAGTTAAGGGGAGGAATGAAAAGGTTATCAAAGCGGCAGGAG
ACAGGAGGAATAACGCAGGACGAGACCCAAAGATAATATTTCTATAACGAAGTCGTTCGA
ACCCATCAGATTTCTGCTTTGATTACATACACAAGCTTTGTTTCTTTCTACAGGTGATTG
TATGTGGGCTTATGGTATGCCTGCAGGACGCGTATGCATGTACGACGGCACGACCCGGAG
CAAAACGGCGAGTGCTCTAACGCGGTGTATGGGCTAGATTCGTAATAGGGCTCTGGGTTT
GCTGCAAGGGGTAATTATCAGCGATGGAATGACTCCGTTACCGCCCGACGCTATGTACGC
CTTTTCCGCGTGCGCCGGTCTTTACCGGCAGGGGAGAATGTGGTGACGGCGGAGCCGGCG
TATGGTGCCTCTACAAAAAATACGAAGTCTCATTTTAGTCACACTGATTTTCATAAGAAA
TGAGGAAAAAGAAAAGAGATGAAAATTGAGAAAAAAAAAAAAGCATTGTCGGGTAACAAA
TTATGTAGTGAAGATCAAAGGATATACACACAAACGAAGATGCGCATTAGCCACGTCCAT
CCCTTTCCCTTTTTCCCTTTCTACTCCGTTTTTACAATAATGTACGTTATAAAACAAGCG
GCTGAAGAACAAGTTGGGAATAAATGTCAGCAAGGAAGATTGGTGTAAAGTGAAATCAGA
TAAGCAACTTAATACACAACCTCAAAAAGAAAAAATTACC
Chr coordinates Chr II from 164772-164488
w3c xhtml validator w3c css validator