Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TOD6
Systematic Name YBL054W
Alias PBF1
Strain S288c
Description PAC motif binding protein involved in rRNA and ribosome biogenesis; subunit of the RPD3L histone deacetylase complex; Myb-like HTH transcription factor, similar to Dot6p; hypophosphorylated by rapamycin treatment in a Sch9p-dependent manne
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TOD6 YBL054W
CAAGGGCATTTTTCACGTGCCTCTGAGCAGCACGCTCTAATAATTTTACATAATCTGCTG
GATGGTACTGCTTACCATTGTAAATACCGTGAAACATAGGATCTGTCAGATTCAATCCAA
TATCATAGTATTTCAGCGGAGAATCCGTGGCAGTTGATGTCATGCTATAATATTGTGTCA
AAATTGGTTTCCAGAGCCTAGAACAACTTTTGTTCGAGGATTTCAATAAGATGCCCCACA
TATAACTATAACAGTACTGGCGCCTCAAAAAAATGCCTTGGCAGCGAAAGTGTCCACCTT
TAGTTGTCCATTGCTACCAGGACATCACCACTGGGCCCTTCCAGCATGCTGGAAAGATTG
TTCTTAGAAGAGTGCTGTTCTAAGTAACCCGGCGTTAGTAGGGGCTAAGCCTTCTAGAAG
GCCGGAAAAGGCTCAGAAATGCCTGCAGTGCAAAGCTTTTCAGGAACGTTACTAGCGCAA
GTCTTCTGGCTGCTGTTTAGCAACCTCTTTGCAGGTATTTCGCAGCGGGATTTCGCAGGT
GTCTTGCCTAGCGTATCAACACTTAGTAGCAGTTAGGTTCTAAAGTTAAACTCCACTTCC
GTTCTTCTTCGAGTTCCTTTTTGAGCGGTTTGGCCTATCTTGTCTCATCATCTTGTTAGT
GTGCGACGTTATCTGTGGGTGAGAGAGGCTATTTTTGGTCCGGTGAAAAAAAAATTTTTT
CTCTGCTGAGAGCTGAAATTTGAAAATTGAGATGAGATGCGATGCGATGAGATGCGAGAC
CAATGCGATGAGACACTTTTCTACTTCCTTACACAGAAGTCGTGTATAGTTTTTGTACGT
TGATATTAATAAAGGCTTTTCATATCATTTTGTTTTCAGGTAAACAAATCTGGCAAATCT
CCACTGCTTGAGTCATTAAAACTACTCACTCAAGAAGGCATATACACGACAGTGGGTAGA
GAAAAGAATATATCACTGTTCTTATTGAAGTTCCCTCGCG
Chr coordinates Chr II from 117589-119166
w3c xhtml validator w3c css validator