Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBL055C
Systematic Name YBL055C
Alias 3'-5'-exodeoxyribonuclease, Tat-D
Strain S288c
Description 3'-->5' exonuclease and endonuclease with a possible role in apoptosis; has similarity to mammalian and C. elegans apoptotic nucleases
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBL055C YBL055C
TAGGGTCCCAAGAAGAGGGGTTGTTTTTTTTGAGTGATTCCGCCTCCTCCTTGTTCGTGC
TGTTCTCTTTAGTGCTAGTGCTACTGATAGGCAGGTGGCTCTTCGCATTTGTGTGAGAAA
GTGAGTGGGAATGGACAAGATTATTTGGGTGAGGGTGTTTGCTTAGTATTGAGAAACCAT
GTGAGTTGGCACTAACATGTCCTGATGAAACAGAAACGCTACTGAGTTTCGGCAACGTCA
TCGCGAGGGAACTTCAATAAGAACAGTGATATATTCTTTTCTCTACCCACTGTCGTGTAT
ATGCCTTCTTGAGTGAGTAGTTTTAATGACTCAAGCAGTGGAGATTTGCCAGATTTGTTT
ACCTGAAAACAAAATGATATGAAAAGCCTTTATTAATATCAACGTACAAAAACTATACAC
GACTTCTGTGTAAGGAAGTAGAAAAGTGTCTCATCGCATTGGTCTCGCATCTCATCGCAT
CGCATCTCATCTCAATTTTCAAATTTCAGCTCTCAGCAGAGAAAAAATTTTTTTTTCACC
GGACCAAAAATAGCCTCTCTCACCCACAGATAACGTCGCACACTAACAAGATGATGAGAC
AAGATAGGCCAAACCGCTCAAAAAGGAACTCGAAGAAGAACGGAAGTGGAGTTTAACTTT
AGAACCTAACTGCTACTAAGTGTTGATACGCTAGGCAAGACACCTGCGAAATCCCGCTGC
GAAATACCTGCAAAGAGGTTGCTAAACAGCAGCCAGAAGACTTGCGCTAGTAACGTTCCT
GAAAAGCTTTGCACTGCAGGCATTTCTGAGCCTTTTCCGGCCTTCTAGAAGGCTTAGCCC
CTACTAACGCCGGGTTACTTAGAACAGCACTCTTCTAAGAACAATCTTTCCAGCATGCTG
GAAGGGCCCAGTGGTGATGTCCTGGTAGCAATGGACAACTAAAGGTGGACACTTTCGCTG
CCAAGGCATTTTTTTGAGGCGCCAGTACTGTTATAGTTAT
Chr coordinates Chr II from 116829-115573
w3c xhtml validator w3c css validator