Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBL055C
Systematic Name YBL055C
Alias 3'-5'-exodeoxyribonuclease, Tat-D
Strain S288c
Description 3'-->5' exonuclease and endonuclease with a possible role in apoptosis; has similarity to mammalian and C. elegans apoptotic nucleases
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBL055C YBL055C
TAGGGTCCCAAGAAGAGGGGTTGTTTTTTTTGAGTGATTCCGCCTCCTCCTTGTTCGTGC
TGTTCTCTTTAGTGCTAGTGCTACTGATAGGCAGGTGGCTCTTCGCATTTGTGTGAGAAA
GTGAGTGGGAATGGACAAGATTATTTGGGTGAGGGTGTTTGCTTAGTATTGAGAAACCAT
GTGAGTTGGCACTAACATGTCCTGATGAAACAGAAACGCTACTGAGTTTCGGCAACGTCA
TCGCGAGGGAACTTCAATAAGAACAGTGATATATTCTTTTCTCTACCCACTGTCGTGTAT
ATGCCTTCTTGAGTGAGTAGTTTTAATGACTCAAGCAGTGGAGATTTGCCAGATTTGTTT
ACCTGAAAACAAAATGATATGAAAAGCCTTTATTAATATCAACGTACAAAAACTATACAC
GACTTCTGTGTAAGGAAGTAGAAAAGTGTCTCATCGCATTGGTCTCGCATCTCATCGCAT
CGCATCTCATCTCAATTTTCAAATTTCAGCTCTCAGCAGAGAAAAAATTTTTTTTTCACC
GGACCAAAAATAGCCTCTCTCACCCACAGATAACGTCGCACACTAACAAGATGATGAGAC
AAGATAGGCCAAACCGCTCAAAAAGGAACTCGAAGAAGAACGGAAGTGGAGTTTAACTTT
AGAACCTAACTGCTACTAAGTGTTGATACGCTAGGCAAGACACCTGCGAAATCCCGCTGC
GAAATACCTGCAAAGAGGTTGCTAAACAGCAGCCAGAAGACTTGCGCTAGTAACGTTCCT
GAAAAGCTTTGCACTGCAGGCATTTCTGAGCCTTTTCCGGCCTTCTAGAAGGCTTAGCCC
CTACTAACGCCGGGTTACTTAGAACAGCACTCTTCTAAGAACAATCTTTCCAGCATGCTG
GAAGGGCCCAGTGGTGATGTCCTGGTAGCAATGGACAACTAAAGGTGGACACTTTCGCTG
CCAAGGCATTTTTTTGAGGCGCCAGTACTGTTATAGTTAT
Chr coordinates Chr II from 116829-115573
w3c xhtml validator w3c css validator