Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IAI11
Systematic Name YBL059W
Strain S288c
Description Putative protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IAI11 YBL059W
CCTTTAACACAATTCGAAGCCGTATCTAACGCAGAATATGGATGGAGTGACAAGATCTTG
ACAGAGCACGCTTCCCTCAATCTTAAAAATATTGTTGTAAGTGAATGGAAGCCACTATTG
GGGCTAGAGCTACTATACGAAGATGCGAAAGATGTAGAGATGGTCGAACTAAAAGAAAGG
CTAAAGGAATTGATGAACTTCACCAGACAGCTTGGTATATGGATAGATAAACATAACGAA
ATAAAGGATAAGCTGGTCGAAATTTGGAGCTTTGACGATAACTATTTTGAAGCAGTCATG
AATAATTGGAATTCGAGATATTTGTATATGAATAATCAATATAAGAAACGACTGAGCTAC
TTGAAAGCTTTGCAAAAAGCCATGGGTTCTGTTCAGTTCTAAGTATATTTAAAGATATAA
ATATAAAGACTGCGCTGAAGAAATATAAACTTGAAAACTGTACTCTGCCTTTTATTTACA
AGGGATATTGAGATGATTTGTGTGAATGAAGTAGCGACAGAAAAAAAGCTTTTATTTCGA
GTTCGCATCATTGTCACTTTCCTGCTTTTTCTTGGCGTACTGTCTATCTAAGATAGTCTT
TAATATAGCGTCCTCGCCATATTCTTCTTCCTCAATTTTCTTCCATCTCTTTTCTACATC
AGCTCTCTTTATTCTACTTTCAATGACAGCACGTTTCTTGTTATTCAAACTTGCCTCCTT
GAGACACTTGTTCAAAGCATCCTTTTCGTTGTTACAAAGGCCAAATATTCTCTTGTAATA
TTCCTTTTGATGGCATTTATCGAGTGCATTGATGAAGTCCAAACAGGCTAAAATGAAGAA
GGGGAGAATACAATGTTAGTAAGTCGGAGCACAGAAAAAGGCAAATATATGAAGTAAAAT
CTGGATACTTACAATGAAAACGTTCAGCTTCTAACTGTGGATGCATGTTGTAGTACTTGT
CTTATCTTGCTTTTGTTCAACTGCACTTGTAAATCAGTGA
Chr coordinates Chr II from 110594-110879,110949-111244
w3c xhtml validator w3c css validator