Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS8A
Systematic Name YBL072C
Alias eS8, rp19, S14A, S8A, S8e, YS9
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; identical to Rps8Bp and has similarity to rat S8 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS8A YBL072C
AGCTGGGACAAACAGCAACTTTTTCGCCCTCAAACATGTCATCCAGATATATTTGAAACC
TATCTCCACAGGGACAAGGATAGGTGAACATTTGATTTTCAGGCTCAAACGTCATATCTT
CGATTTCGATTTCGTCATATGTTGACATTTCAGCTGGTAATGTATTGTACAAATGATGTG
CTTACAGTCGTGGTATGTATGTGTCTTTGAAAAAAAAAAGCGATGAGAAGCTCTTTATAG
CGATAATATAGGTCCTTTTTCGGATTTGTCTCCACCCATTTCTTTTTCATCTGCTCTAAC
TTTTGTGACTTTACATCCATACACCCTCTTTAACACCCTTACACTTTTACAAATTTTCCT
TTTTCATCAACTTTAAAATTATTGCGTGAGAAGTTCCTATTTTCTGATTTTCTCAGCGGA
ATAACCTTTTAGAATCCTGAGCTGCGAGCAGAGCGGCCTCGCCAAACCCGTGCTGGGCCT
AGTTCCCCCCTCCATGTTCGGTCCTACACACGAGCATCGCTGGGAAAGCTTGAGGGCTTT
CTCTTACGCAGTGTTCATGGTGTTACGGGATGGAACTGTTTCATATACGTTATTTACAGG
CCTATCTTAAAGTTATAGGAAATTACACTTGCCATTTGCTTTTTGGTACTCACAAGAAGA
CGTTATAAACACACCAGGACAAAAAGTATGTGCTATGGTCATATGAGTAATGGAACTACA
TATTATTTTGAATGCTACAGGACCTCTCTTTGAATGGAATAGATAGTGGAAAAAGTAAAC
TTAACTAAAAGGGATGATATAAATTGTGACAGGAGCAGTGCACTAAACTGAATCCTTTGT
GTACCCAAAAAATCAAGCCTCTTATGAAACGCCGAGTTTTTCACAAGAAGAGATGAAAAG
AAACCAAAGCATATTTCAAGATAAGAAAAAAATTCCGCAACTTTTGTACGTTCTTTATTT
TACTAACAAGCGTCATTAAATTTTCTATTACAGTTACAAA
Chr coordinates Chr II from 89125-88523
w3c xhtml validator w3c css validator