Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ILS1
Systematic Name YBL076C
Strain S288c
Description Cytoplasmic isoleucine-tRNA synthetase, target of the G1-specific inhibitor reveromycin A
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ILS1 YBL076C
ATTGTCCCTAGGAATTGAAACTGCAGGCGGCATAATGACTAAGCTAATTCCTAGAAACTC
AACGATTCCAACAAAGAAATCGGAAACCTTCTCTACCTATGCAGATAATCAACCTGGTGT
TTTAATTCAAGTCTTTGAAGGTGAAAGAACAAGAACAAAGGATAATAACTTACTTGGTAA
ATTCGAATTAAGTGGCATTCCGCCTGCTCCCAGAGGTGTGCCTCAAATTGATGTTACCTT
TGATATCGACGCTAATGGTATTCTTAATGTGTCTGCTTTGGAAAAGGGTACTGGTAAGAG
TAACAAAATCACGATCACTAACGATAAAGGTAGGCTCTCGAAGGATGATATTGATAGGAT
GGTTTCTGAAGCTGAAAAATATAGGGCTGACGATGAAAGGGAGGCAGAACGAGTTCAGGC
TAAGAATCAGCTTGAATCGTATGCATTTACTTTGAAGAATACCATAAACGAAGCAAGTTT
CAAAGAGAAAGTAGGTGAAGATGATGCAAAGAGATTAGAAACAGCGTCTCAGGAAACCAT
TGACTGGTTAGATGCATCGCAGGCAGCCTCTACGGACGAATATAAGGATAGACAAAAGGA
GTTGGAAGGCATTGCCAATCCAATAATGACGAAATTTTACGGTGCTGGTGCCGGCGCAGG
TCCTGGAGCGGGGGAATCCGGTGGATTCCCCGGATCCATGCCCAACTCGGGTGCTACGGG
AGGTGGAGAAGATACAGGTCCAACAGTGGAAGAGGTTGATTGATTATTCTTCTATAGTGT
TCTATTTAGCTACTTTTTATGTTTAACCTTTTATACGATGGCGGGTAATCTATCCATGAT
GACGAAAAATTTTTTTTTTTTTTGTTTCCGCAGCACGCAAGAAATCTCGAAACAATGATG
ACTCTTAAGCATGAAAAATATCATTTTGCGCTTTAAACTAGAGTGATGTTACTCGACTTC
CTACAACCTTTAGCCAAAAGCTTCAAAAAACCAAGGAAAT
Chr coordinates Chr II from 84261-81043
w3c xhtml validator w3c css validator