Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG8
Systematic Name YBL078C
Alias APG8, AUT7, CVT5
Strain S288c
Description Component of autophagosomes and Cvt vesicles; undergoes conjugation to phosphatidylethanolamine (PE); Atg8p-PE is anchored to membranes, is involved in phagophore expansion, and may mediate membrane fusion during autophagosome formation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG8 YBL078C
CCTTAAAAACTCCATTGAAGACTTTGGTCATCCTTCACAGTGATGAATCATACTTGAAGG
ATGTAGAAGCCTTGAAAAACTACATTATCGAGGAATTAAATGTTCGTGATGTTGTTATCA
CCTCCGATGAGGCAAAATATGGTGTTGAGTATAAAGCAGTTGCTGATTGGCCTGTATTGG
GTAAGAAGTTGAAAAAAGACGCAAAGAAGGTTAAAGATGCCCTACCATCAGTCACTTCTG
AGCAAGTACGGGAATATTTGGAAAGCGGAAAGTTGGAGGTTGCCGGTATTGAACTGGTTA
AAGGAGATTTGAATGCTATTAGAGGCTTGCCAGAATCTGCTGTCCAAGCTGGACAAGAAA
CCAGAACCGACCAAGACGTGTTAATCATCATGGATACAAATATTTACTCTGAACTAAAGA
GTGAAGGTCTCGCAAGAGAGCTGGTCAACAGAATCCAAAAATTGAGAAAGAAGTGTGGTT
TGGAAGCCACCGACGATGTTTTAGTGGAGTACGAATTAGTTAAAGATACTATCGACTTTG
AAGCCATTGTCAAAGAACATTTTGATATGTTAAGCAAGACCTGTAGATCCGACATTGCCA
AATATGACGGCTCAAAGACAGACCCAATTGGTGATGAAGAACAATCTATTAATGACACCA
TTTTCAAATTAAAAGTGTTCAAATTATGAAAACAACTCATATAAATACGTACAAATTTTT
CTCTACTCGAAGTGATATAGATGTATATGTGTAAGTTTACGTTTAAGTTAGAGTCATGTA
ATGCTAACTGTCTCCACCGATAATGTTGTATAATACCCGTGAAATCATAGCACATGATAT
ATCATCACCCGGAGGCCGGTTATTTTCGGCGGCGGCAAAAATATTTGGTATAATTATGGA
AATACAAAAAGGGGAACCATTAAAGGTTGAGGAGGGGATTGATAAGAGAATCTAATAATT
GTAAAGTTGAGAAAATCATAATAAAATAATTACTAGAGAC
Chr coordinates Chr II from 80731-80378
w3c xhtml validator w3c css validator