Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG8
Systematic Name YBL078C
Alias APG8, AUT7, CVT5
Strain S288c
Description Component of autophagosomes and Cvt vesicles; undergoes conjugation to phosphatidylethanolamine (PE); Atg8p-PE is anchored to membranes, is involved in phagophore expansion, and may mediate membrane fusion during autophagosome formation
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ATG8 YBL078C
ATGAAGTCTACATTTAAGTCTGAATATCCATTTGAAAAAAGGAAGGCGGAGTCGGAGAGG
ATTGCTGACAGGTTCAAGAATAGGATACCTGTGATTTGCGAAAAAGCTGAAAAGTCAGAT
ATTCCAGAGATTGATAAGCGTAAATATCTAGTTCCTGCTGACCTTACCGTAGGGCAATTT
GTTTATGTTATAAGAAAGAGAATTATGCTACCCCCTGAGAAGGCCATCTTCATTTTTGTC
AATGATACTTTGCCACCTACTGCGGCGTTGATGTCTGCCATATATCAAGAACACAAGGAT
AAGGACGGGTTTTTGTATGTCACTTACTCAGGAGAAAATACATTTGGCAGGTAG
Promoter Sequence
Download FASTA
>ATG8 YBL078C
CCTTAAAAACTCCATTGAAGACTTTGGTCATCCTTCACAGTGATGAATCATACTTGAAGG
ATGTAGAAGCCTTGAAAAACTACATTATCGAGGAATTAAATGTTCGTGATGTTGTTATCA
CCTCCGATGAGGCAAAATATGGTGTTGAGTATAAAGCAGTTGCTGATTGGCCTGTATTGG
GTAAGAAGTTGAAAAAAGACGCAAAGAAGGTTAAAGATGCCCTACCATCAGTCACTTCTG
AGCAAGTACGGGAATATTTGGAAAGCGGAAAGTTGGAGGTTGCCGGTATTGAACTGGTTA
AAGGAGATTTGAATGCTATTAGAGGCTTGCCAGAATCTGCTGTCCAAGCTGGACAAGAAA
CCAGAACCGACCAAGACGTGTTAATCATCATGGATACAAATATTTACTCTGAACTAAAGA
GTGAAGGTCTCGCAAGAGAGCTGGTCAACAGAATCCAAAAATTGAGAAAGAAGTGTGGTT
TGGAAGCCACCGACGATGTTTTAGTGGAGTACGAATTAGTTAAAGATACTATCGACTTTG
AAGCCATTGTCAAAGAACATTTTGATATGTTAAGCAAGACCTGTAGATCCGACATTGCCA
AATATGACGGCTCAAAGACAGACCCAATTGGTGATGAAGAACAATCTATTAATGACACCA
TTTTCAAATTAAAAGTGTTCAAATTATGAAAACAACTCATATAAATACGTACAAATTTTT
CTCTACTCGAAGTGATATAGATGTATATGTGTAAGTTTACGTTTAAGTTAGAGTCATGTA
ATGCTAACTGTCTCCACCGATAATGTTGTATAATACCCGTGAAATCATAGCACATGATAT
ATCATCACCCGGAGGCCGGTTATTTTCGGCGGCGGCAAAAATATTTGGTATAATTATGGA
AATACAAAAAGGGGAACCATTAAAGGTTGAGGAGGGGATTGATAAGAGAATCTAATAATT
GTAAAGTTGAGAAAATCATAATAAAATAATTACTAGAGAC
Chr coordinates Chr II from 80731-80378
w3c xhtml validator w3c css validator