Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PKC1
Systematic Name YBL105C
Alias CLY15, CLY5, CLY7, HPO2, STT1
Strain S288c
Description Protein serine/threonine kinase essential for cell wall remodeling during growth; localized to sites of polarized growth and the mother-daughter bud neck; homolog of the alpha, beta, and gamma isoforms of mammalian protein kinase C (PKC)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PKC1 YBL105C
TGTATTAACTGCAGACATAAAGCCCCGGCAAATATATATCCAATGTCAAAACTGTAAACA
AAACATCAACACTCCGCGCACATCCTCACCTTCTAGCGCCGTCTCTACTAGTGCTGGAAA
TTACAAAAATGGTGAAGCCTATAGAAGAAATAACGCTGACTACAAGAAATTTAATACTGG
AAGTTCTGAAGCACAAGCAGCTGATGAAAAGCCAAGACATAAGTATTGTTGCCCACACTG
TGGGTCTTCATTTCCAAGATGTGCCATATGTCTCATGCCTCTAGGAACGTCAAACTTACC
TTTTGTAATAAATGGGACGCAATCACGCGATCCAATGCAGACAGAAGACTCTCAAGATGG
TGCAAATCGCGAACTCGTAAGTAGAAAACTGAAGTTGAACGAGTGGTTCAGCTTCTGTTT
GAGTTGCAACCATGGTATGCATGCCGGTCACGCTGAAGAATGGTTTGACAGACATAATGT
TTGTCCCACTCCAGGTTGCACCTGCCAGTGTAATAAGTAGTATTGTACAATAAACCAAAT
CTTGCAACTTCTCTTTATTCTCACAATATATATACATAACCAAAGAAAAAACGTAATTAG
TATAACATTGTATTTATGAGGCATTGCTATCTTCATTACCCAGCCCGCCTAGTTTTAAAG
GCGAAAAAAACCGACGAAAAGAGTTAACAAGCGTGGATAATAAAGTTGATCTACTCTATC
GAAAGTAATACGACAGGTTCAGGAGCAGTAAAAGAGCTACGATTTCACTGCTATTCAATT
TGGCTGAGTAGAGACTGATTATTAACCATTGTAAAAGTCTCTGCCACCACTCGTCCACAC
TTACGTTAGAGGTATTCAGCGTCGATCCCCTTTCAGTATAGATTTTTAAAACTATATTAG
ATAATCAATAGGAATAAAACCTAGAACAGTAGCTGCGGAGAGAAGCTCTAGCGAGGAAAA
GTAAGTATAGTATCACACATATAGGGAGCAGTTTACAGTC
Chr coordinates Chr II from 17696-14241
w3c xhtml validator w3c css validator