Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBL112C
Systematic Name YBL112C
Strain S288c
Description Putative protein of unknown function; YBL112C is contained within TEL02L
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBL112C YBL112C
CGAAAAAGGCCCCGAGAGCCCAAGAGTACAAACGATATCCTCGTCGCAGGCCGGAAACTC
TTTGGCAGCTCCTTTGAATTCAGGGACTTGCATCAGTTGCGCTTATGTCATGAAATATAC
ATGGCAGACACACCCTCTGTGGCAGTACAGGCCCCACCGGGCTATGGTAAGACGGAGTTA
TTTCATCTCCCCTTGATAGCACTGGCATCTAAGGGCGACGTGAAATATGTGTCGTTTCTG
TTTGTACCGTACACAGTGTTGCTTGCTAATTGCATGATCAGGTTGGGCCGACGCGGTTGC
TTGAATGTGGCCCCTGTAAGAAACTTTATTGAAGAAGGTTGCGATGGCGTTACTGATTTA
TACGTGGGGATCTACGATGATCTTGCTAGCACTAATTTCACAGACAGGATAGCTGCGTGG
GAGAATATTGTTGAGTGCACCTTTAGGACCAACAACGTAAAATTGGGTTACCTCATTGTA
GATGAGTTTCACAACTTTGAAACGGAGGTCTACCGGCAGTCGCAATTTGGGGGCATAACT
AACCTTGATTTTGACGCTTTTGAGAAAGCAATCTTTTTGAGCGGCACAGCCCCTGAGGCT
GTTGCTGATGCTGCGTTGCAGCGTATTGGGCTTACGGGACTGGCCAAGAAGTCGATGGAC
ATCAACGAGCTCAAACGGTCGGAAGATCTCAGCAGAGGTCTATCCAGCTATCCAACACGG
ATGTTTAATCTAATCAAGGAGAAATCCGAGGTGCCTTTAGGGCATGTTCATAAAATTTGG
AAGAAAGTGGAATCACAGCCCGAAGAAGCACTGAAGCTTCTTTTAGCCCTCTTTGAAATT
GAACCAGAGTCGAAGGCCATTGTAGTTGCAAGCACAACCAACGAAGTGGAAGAATTGGCC
TGCTCTTGGAGAAAGTATTTTAGGGTGGTATGGATACACGGGAAGCTTGGGTGCTGCAGA
AAAGGTGTCTCGCACAAAGGAGTTTGTCACTGACGGTAGC
Chr coordinates Chr II from 2899-2582
w3c xhtml validator w3c css validator