Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RCR1
Systematic Name YBR005W
Alias SSH6
Strain S288c
Description Protein of the ER membrane involved in cell wall chitin deposition; may function in the endosomal-vacuolar trafficking pathway, helping determine whether plasma membrane proteins are degraded or routed to the plasma membrane
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RCR1 YBR005W
TGATAATAGTGGGAAACATATTGCTTTTACAAACTTCCTGTTCTTTGTTAGTTCAATAAG
GTCAAAAATAAAGTAAATCCCTAACAAAACACAGTTTGAACGATTCAAGGATGCTAAGGT
AAAGCAAGCCATGCTGATAAAGGAGTAAGGAAACCAATATCTCCACGAAATATCGAATTG
ACCCAATACGGGCACGGAAATGGAGCATTCACGACTCCAAATACCAACAAATGCAAAAAA
AAAAGATAATGGTTCAGAATATATGCTTGTTAAAAATCCAGCGGCACTCGTTAAGAAAAA
CAACAGAGATGTTTTTTTAGCGATAGTTCTAGCAAACTGTGATTGCCTTATATTTTGGCT
GAAAATTTTTTTTGTTAGAAAATATAAAACAATACCTGACAAGTAAAATAAAACATTTTC
TATTGCAACTCCAACCCTTAAGGCATGGTAGATGCTATCGTTATTACTTTTAATAAACAG
CCTAACGAAAAAAGTCCACAACTGAGAAAACGCGTATTCATGCTCAAATTGAGGTTTTCC
GTTTTTGGAAGTTATGTTCTTGATAAAAAAAACACTGTCCCATGATAGTAGCTTATTCCA
AAAATACTTGTTCCAATAACTGTTGATTTCAGAGGGAGAAGAACATAATTCGTTTAATAA
AAGTGATGTTGATGTATCAAACTGCCTAATTGGAGTCAAAAAAACCAGTAAATACTGTAT
TGAACGGAATAATACAAAATAAAGTGTCAACCCCACAATCATATTTTAATTTAGTCTTAT
TCCGCCTCCTCTCTCGAAGCCTCTCTTTTATGTCTTTTTTCGATGATGAGGCTTACTTTT
TTTTTCAACTAAGCCTTGAAAAAAAAAGTTTGATTTAAAAGGGATTTTCTATTTTAAGTA
TTTAAATGACCGACAGGAAGCTCATGCAGAAAAGGCACCTGTAATAGCTTATTGATCATT
CCAATAAATAGGAAAGTATAACTCGAATTAAGAATAAGGA
Chr coordinates Chr II from 245906-246547
w3c xhtml validator w3c css validator