Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UGA2
Systematic Name YBR006W
Alias UGA5
Strain S288c
Description Succinate semialdehyde dehydrogenase involved in the utilization of gamma-aminobutyrate (GABA) as a nitrogen source; part of the 4-aminobutyrate and glutamate degradation pathways; localized to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UGA2 YBR006W
GTCATGGCAGTCAGGAATATGGATTTTGTTTGTGCTGTTTGTTGCCGCAGTAATCCTTAT
AATACTGTTCACTTTTGTAGCGAACAGAAGGAGACGAAGGATGGGGCGTGCTCCCATTAG
AGGTACGGCATGGTTGACACCGCCTTCATACAGACAGTCTCAGCAACAATATACTGGGAC
CGTTCAGCAACGGACAGATGATTATGTTCCTGAGTATACAGAAACAGCGAACGAACATGA
TCTTGGATACTATGACCAGCGGGGCGAGTTTCACCCCAACGATAAGGCTGCATACGTGGC
CCCCCCGCCATTGGTACAAGAATGTTCATCAGAATCTGTTAATTCTTTAGAAAGACCTCC
CGCTGCTGTAGTTCACCAAGCTAACTCTTTAGATACGGATTACGGTTTAACAAGGCCTAG
CAATGGGCGCGTTCCAGCTGTAAGTGATACGGTGGAGCAATTGGAAAGGCTTCCGGGCGG
GACTACAACGCAGGAAATTAACCCACCGGAGAGGGCAAAGGTAAATGCAAGGTCATGAAC
TGAATCTTTTTTTCCGGCTGTCCTCTTACAGTTGAGTTACAATATTTTGCCAGAAATATT
TACATTTTTTTACCCAATCTCTATAATAATTATTTTAATTCCTAATCCGCTTCAGGCCCG
CGGTCGTTGAAGTGCTATAGTTTATATTCAGTACATTGTCTTTAATCTCTCAGTATTATT
TTATCAATAGTAAATACTTCAAGTCCATCGCACGGCGTGGTGGTGATAAAGGGAAAATGC
GCGCGGGATTAGCAAAGGCGGCCAATGGATTAAGGGTGACAAGATAGCACCACATCACAT
CACATCACCATCAGTAATGGAGAGGAAATAGGGTATAAATACTCGTCAGAGATCAATAGA
TATTATTTCGCAACGTCCTTTATTGTTCTGTTCTTATTTGATCAATTAAGCTAGAAAACC
AGCTACATTAAAAGCAAATTTTACAAACTACTATTTCAAC
Chr coordinates Chr II from 247010-248503
w3c xhtml validator w3c css validator