Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HHT1
Systematic Name YBR010W
Alias BUR5, histone H3, SIN2
Strain S288c
Description Histone H3, core histone protein required for chromatin assembly, part of heterochromatin-mediated telomeric and HM silencing; one of two identical histone H3 proteins (see HHT2); regulated by acetylation, methylation, and phosphorylation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HHT1 YBR010W
AAATATTTGCTTGTTGTTACCGTTTTCTTAGAATTAGCTAAATTAACCACCGAAACCGTA
TAAGGTTCTACCTTGTCTCTTCAAAGCATAAACAACATCCAAAGAAGTAACAGTCTTTCT
CTTGGCGTGTTCGGTGTAGGTAACAGAGTCTCTGATGACGGATTCCAAGAAGGATTTCAA
GACAGCTCTGACTTCTTCGTAGATCAAACCAGAAATACGCTTGACACCACCTCTTCTAGC
TAATCTTCTGATAGCTGGCTTAGTAATACCTTGGATGTTATCTCTTAGAATCTTTCTGTG
ACGCTTGGCACCACCTTTACCTAGACCTTTACCACCTTTACCTCTACCGGACATATTTTA
CTATATTATATTTGTTGCTTGTTTTTGTTTGTTGCTTTAGTACTATAGAGTACAATAATG
CGACGGAAACCATCATATAGAAAAAATATCTCGGTATTTATAGGAAAAAGAATTAGACCT
TTTCCACAACCAATTTATCCATCAAATTGGTCTTTACCCAATGAATGGGGAAGGGGGGGT
GGCAATTTACCACCGTATTCGCGGGCATTTGCTAAAGTAAACAACTTCGGTTTTTACCAC
TAACCATTATGGGGAGAAGCGCTCGGAACAGTTTTACTATGTGAAGATGCGAAGTTTTCA
GAACGCGGTTTCCAAATTCGGCGGGGAGATACAAAAAAGATTTTTGCTCTCGTTCTCACA
TTTTCGCATTGTCCCATACATTATCGTTCTCACAATTTCTCACATTTCCTTGCTCTGCAC
CTTTGCGATCCTGGCCGTAATATCTCTCCTTGACTTTTAGCGTGGAAGATAACGAAATGC
CCGGGCGATTTTTCTTTTTGGTACCCTCCACGGCTCCTTGTTGAAATACATATATAAAAG
ACTGTGTATTCTTCGGGATACATCTCTTTCCTCAACCTTTTATATTCTTTCTTTCTAGTT
AATAAGAAAAACATCTAACATAAATATATAAACGCAAACA
Chr coordinates Chr II from 256331-256741
w3c xhtml validator w3c css validator