Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IPP1
Systematic Name YBR011C
Alias PPA1
Strain S288c
Description Cytoplasmic inorganic pyrophosphatase (PPase), homodimer that catalyzes the rapid exchange of oxygens from Pi with water, highly expressed and essential for viability, active-site residues show identity to those from E. coli PPase
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IPP1 YBR011C
GTTGGAATGAAATTTTAATATCATCTATTTCGCAGCACTCATGTTACTATTATATCACAT
GCGGTGTAAGAGGATGGCATAAAGATTGAGAAACAGTCATCCAATCTAATGGAATGCACG
ACACAATAATGAGTGACAACATATAAAAGGAAGTAAGATACAATAATATTATTATGTATA
ACTATCGATTTCCTTTTGTGGATTCCTATATCCTCGAAAAGAACTTCTAGTATAATCTGT
GTACCTAATATTACAGCCTTTGAAAACAATGGAATCCCAACAATTATCTTATTCCCATAA
TTCTCATATACAAGATACAAGGGAGAAGTAAACAATGGATACAAGGAGAAATATGGCGCT
AAAGGCTGATTTAATTGGATTGTTCGATTCGAAGTCGCTCAATAGAATTTGATGGCTCCC
TCAGAGTGCGGTTCAAATCATTCGGATACTTTGAAGAAAGGGTAATATATTGTACCTTTG
AACATGAGTTCATGAGTTGAAAAAGGTAAAAATAATCTGCTAAAATGATTACTCTTCTCT
AAGAATGTGGTCTTCCCCACCCACGTGATAGTAATACATAGGAACCGTTTTACTGAACGC
TACATTACCCATCAATATAATATCATGATTTAGCCGCCGAATTTTATGTAACTAAAAGGT
TGCGGGACTTTGAAGCCCAGGTAGAAGTGTTTCATTCACAGAAGGAGATGCCAATGTGCT
ATTATTATCCCTGTGTGGCGCACTATTCAAACGGATTTGACTGTTCTTCAAAATATCGTC
ATCGCAGACGCTAAGGTTGTTGGGAGAAGCCACAGTCATTAGATACGATAGTCTCATGAT
GACTTTTTCTCGTTTTTTTTCGACGTTTTAAGGTCGCGTCGAAGTTAGGAAGGTTAGTTC
ATTTACAACTTGTTTTTGAATACTTACTTTCTTAATCATCTATTTTGATTTGTTGTCCCT
TAGGTCTATAGAACAGGATATCCCGCCGCGCAATTTACTA
Chr coordinates Chr II from 257975-257112
w3c xhtml validator w3c css validator