Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EDS1
Systematic Name YBR033W
Strain S288c
Description Putative zinc cluster protein; YBR033W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EDS1 YBR033W
AAGTCTGGGGTTCCGAAACCGTTGCCTCCTCCAAGGTCGGCTACACTTTGCCATCCCATA
TCATCTCCACTTCTGATGTCACCAGAATTATCAACTCTTCCGAAATCCAATCTGCTATCA
GACCAGCTGGCCAAGCTACTCAAAAGCGTACTCACGTTTTGAAGAAGAACCCATTGAAGA
ACAAGCAAGTCTTGTTGAGATTGAACCCTTACGCCAAGGTCTTTGCTGCTGAAAAGCTAG
GTTCCAAGAAGGCTGAAAAGACTGGTACCAAGCCAGCTGCTGTTTTCACCGAAACTTTGA
AACACGATTAAACTTATTAGTACATTAAAAATATTCTTTTATTTTTTATATACATACATA
AGCCTTTAATACCTTTAAAGCGGTAACGACTGCCTCTTGAACTTAAAATTATTCTTTTTT
TTGGATATTTGTTCGTTATGTTTAATGTATATATGTTGATGTTCGATCAGTTTTACGATA
TGCTCTTATAGGAACATTTACAGTTTTCCCCGCATTGAGTCCAGACCGAAGGTTACATAC
AAGATTTCTTCAGCGTTTGTTACTTCAGGAAGGCAATGGTAATCATACGTATCACATTGA
GCAACCTACTGAGGGAGAAAGGAGATTTGTGCCTGGAACTACTTCGTGTAGACAAAGGAA
TATACCCCTTTGATACTTCTCAACCAATTGGTAGTATGCAGGTGCTGCTCCCCCACGCTA
GTAATTACCCCGGTTCCGCTCAATTTTATCTTTTTGACGCGGCTACGAAACTCGGTTTCG
AGCAGTCCGTTAACTTAAACTACAGTGAAAATCATTGGTTAAACAACACTCCATGCCAGT
ATCTGTATGTGTTTTTGCAACAAGCACGACTGGAGTAATAAAGAGTCACGCTAGCAAAAT
TTGTCTCTATAAGATTAAGATTCTGCTTTATAGCTTTGGAACCTTTCGTAGCTGTAGCCC
GCTACGTAGAAATACATAACAATAGAATAATCTTTCAAAA
Chr coordinates Chr II from 301944-304703
w3c xhtml validator w3c css validator