Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FIG1
Systematic Name YBR040W
Strain S288c
Description Integral membrane protein required for efficient mating; may participate in or regulate the low affinity Ca2+ influx system, which affects intracellular signaling and cell-cell fusion during mating
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FIG1 YBR040W
TTGAATGATCAACCAAACGCCGATATAGTCACTATTGGTGATAAAATTAAAATGCAGCTA
TTGAGAACCCATCCTAACAACATTAAATTGTCTATTAATGGAATTGGTAAAGATGCCCCA
ACTTTCCAAGAATCTGCTTTGATTGCCGATAAGTTATTGAGTGTCATGAAGGCCGGCACT
TACCCAAAGATTTCCATTTTCTACAATGACCCAGTGTCTTCCCTATCTTTTGAACCATCT
GAAAAACCGATCTTTAACGCCAAGACCATTGAACAATCCCCATCATTCGGCAAATTTGAG
ATCGACACGGACGCAAACGTTCCAAGAGATTTGTTTGAATATACTTTGGCTAACCAAATG
TTGACAGCAATGGCTCAAGGTTATGCTGCTGAAATTTCCGCCAGAAGAAACGCTATGGAT
AACGCTTCCAAGAATGCCGGTGATATGATCAATCGTTACTCTATCTTGTACAACAGAACA
AGACAAGCTGTCATTACTAATGAACTGGTTGATATTATTACTGGTGCTTCCTCTTTGGGA
TGATAAAAAAATCACCCTGCATTGCCTCTTTATTTGACGTTGTTTTTGTAGAACATGAAA
CGAATTTTGACTTGATGAGACGAAGTATATATCCAAAGAATACCTTAAATAGAAAAGGAA
AGATAATAAATACTAAACACTACTATATATTCAGGTAAAATACAAAAATTATAACATTTT
TAAAACTTTTTTTTTTTGAAAGTCCTTCTCGCTTTAGGATTTTTTCCCATTAAGATTATG
ATGGTTTCATGTATGTGTCAGTTAAAAAAAATATGGCTAAGTAGCAATGAAACGAACCAA
GAAAATGAAAACAATATATAGTGCTGTTGAAATAACAAAGACATTGGTATATATTTGTAA
AATGTCTGTTAAATGTTTTTTATCTCAGGTTCTTGCTTGTCTTTGGTAGAAGAAATTATA
GTAAACAAACAAACAAACAAACAAAAAAAAAAAAAAAAAA
Chr coordinates Chr II from 316968-317864
w3c xhtml validator w3c css validator