Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RFS1
Systematic Name YBR052C
Strain S288c
Description Protein of unknown function; member of a flavodoxin-like fold protein family that includes Pst2p and Ycp4p; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm in a punctate pattern
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RFS1 YBR052C
TCCGAATGTCCTGAATTGAGTACAGACAGAGCATATAAGTTGAGATCTAATGATGGGAAC
GTTTCGCCAGATGGAAAATATATTTATGTGGGGCTAATGAGCGATTTTCCATTTGATTTG
GAACCTATTGGGTGTTTGCTTCGTGTTGACCTATTAGCTCACAAGATAGAGCTTGTTTGG
AATTGCTTGTTAATTCCTAACGCGATCCACTGGGATGAAAGTGATCAAAAGACGATGTAC
GTGACTGATTCTTTAAACTTCACTATTTGGAAATGTCCTGGTGGCGACTTGCTAAAACGT
GACGAGTTAATTGACGTGAAGAACTCCAACAATCAATCTTTTGAGTCTCCTGAACCAGAT
GGAAGTGCAATTTGGTTTAGCAAAGACGGAAAACATTCTGGGTTTCTGTTTATCACTGTC
TGGTCCACCAGTAAGGTTCAAATGTTCGATTTAACTAACGGAAAATTGCTGAAGGAGTTC
ATTTTGCCGGAGCAGACACCAAGAGTTTCATGTTGTTGTTTTGTTGGTAAAGATCTCTTC
GTGACCACTGCCAATGCAGAAATCAACGATGCTGTAAGAACCAATACTGACAAGAATGGT
GGCTGCATCTACAAAATTCCAAACGTGCTAGACGGAAATGTTCCTCTGGAATCTACAAAG
CGACAACCTCTCCACTAGGTGTATATACATATGTTTATATATATGCAGCATACGTATCCA
GCGCATGTAACTAGCGTCATATGACACCGCTTATGGGCAAATTGAAGCGAAGCTCCCAAA
CTTGTCCTTATACATCGAATAATAGCCGTTCCATTTTGGTTGCCTAGTTATAAGGAGGGA
ACACCTAAGGGGCGGACAATCAAAAATACATAAAAGAGCGGAAAAGAAAAGAAATAAAAA
GAAACCACATTTTATATCACACTTTTCTCGAGAAACATCGAACATCAAGACCTCCAGCAT
ACTACTCACTATTATAAGCACATACTACGCCACATAGATA
Chr coordinates Chr II from 339352-338720
w3c xhtml validator w3c css validator