Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YRO2
Systematic Name YBR054W
Strain S288c
Description Protein of unknown function with similarity to archaeal rhodopsins; the authentic, non-tagged protein is detected in a phosphorylated state in highly purified mitochondria in high-throughput studies; transcriptionally regulated by Haa1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YRO2 YBR054W
AACTTAGCTATGTAGGCCGGTGTGTTTGTTCATATCACGGCATACGTTAACACAATGTAA
ATCTTGCTTTGGGTTGACTGAGGGAAATAACTATAGACATCACACCAATGGCTAAGGGAT
ATTTCGACCTCGCTATGGGTTCTAAATGAGGGAATGGAAAAAAAGGGTAAATTGAAAACA
ACCTACCGATTTTGGTACCACTTCCGTGATTTTCGATTCTTCAATTTCCGCATAATTTGC
CTCAAATAGGAAATCTGAGCTGTTTTTTTCTTACCCTCGAGTGGTCGTTCTGCGGACTTT
TCTCCGGTCCAATGCATGAATCCCTTTAAGAAGCATGAAGAAAAAAAAAAATAGCCTCTT
GTAAAAGCAAAAATGCCTTTCACTATTTCTGTGTAAACGAATAATTTCGTCATCTTAGTA
GTTCACTGGATAATTGTGCTTTCCAATCAGATTAGTTAGTAAAACCCCTAGAAAATTTCA
ATGTTAGATCGGGATGATTCCTCATCGGGTTGTTGCTTATTCATGATCCTTTCAATTACT
GGAAGCTTACCGAAAAGATATATAAAGAACCGAACTTATTCGGTTTACATGTAAGACAGT
GTGTTAGTTATGGTTTTCCGCCCTTTTCTTCTCTTGTTTTCTTCGATATTTGTTATTAAC
CTTTTCTCATTTACGATTATATAATCAAGTGTCAAGATTGTGTCAGCAAATAACAGTAAT
ATTCCAACCCGAAAAAAACTATCTATTTATCTTTGGATACTTTAACATAGACAAGAAGTC
CTAAGAACTTACCATAATTTTTTTTCTAAAAACCCTTTTTTACTCAAAACTAATAGCTTA
TTCTGGTTATTTTTAATCAATCTAGAATTTTTTTCTTTTAATTCCAAACAATCTAATAAC
GTTTAACCACTAATTCTTTAATTATTAATATTTAATTTTAAAAATCTTCTAATTTTCCTG
ATAACTTAAAGTGACACTATTTTTTAAAAAAAGCATCAAA
Chr coordinates Chr II from 343101-344135
w3c xhtml validator w3c css validator