Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBR056W
Systematic Name YBR056W
Strain S288c
Description Putative cytoplasmic protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBR056W YBR056W
TAATTGCTCTTGAATTCTATTTCTCTTGTTTCTTCTTGTAAAATCTGTGGCATCCGGAAT
ATCCATCCACTCACTCTCCGTTACAGCAGCTAATGATTCTTTCAAATCGGCAAATTGCCG
TTTCACGTTTGAAGAATCAACTGAATTGTCATCATCCTTTTCATTAGCTCTTTTCTTTTT
CTTTTGTGCTAATTTCAATTCAAGCGTTTTGAATACATTTGCAGCTTCATCATCTTCATC
ATCTTTCGGTTGGCTTTGAAGATGGTTGTTCAAATTTTCACGGTACCTTTTCGGTATTCT
TCTTCCTTTGTCATCATTACTAACCACTTGCTTTTCTTTTGTTGAAAATCCAGTGGCTCC
ACGACCAATACCTGGTACGTAACCTGCAGGTGGTTCTTGATCCAAAAAAGATGGCCTCTC
CATAAAATGTGACGTTTTCTTGCTGTTAAACTCTTTATGTCAACTCACCCGTATATTTTC
TGAAATTTTTCGTTTTTTTTTGCTTAATAGAACAATCTGACACACTATAAATGTACTGGT
TAAATTAGCCCAAGGTTCTATCAACGGTAAAGAAGACTTTTAAAAATACTTTCGTTACAT
TATTTATTAAAAGAAGAAACGCCATCATTTCATAAAGGTCTCCGGAGGAGCTACTAAAGA
AAGAGTGCTGCAATTAATACAATTAATATAAGTGTGGTTATTGAAAATAACTATTCATTT
ATACGGAGGGTTGGCCGAGTGGTCTAAGGCGGCAGACTTAAGATCTGTTGGACGGTTGTC
CGCGCGAGTTCGAACCTCGCATCCTTCAGTAATATTTTTTTAATATACATTTTCTCTGCC
ATCATGGCTTAAAAAATGCTTAAAAGAAGGGAATTAGGGGGGATGGATGAACTAAGACAT
AACTTTCTTTTCTTCAATTCGAACTCTGTTGGGAAGAGTTGCTTTAAAAAAGACTCTCTA
TCCATCTATAAAATTTATTAAAACTTTTGAACTGCACAGA
Chr coordinates Chr II from 347879-349384
w3c xhtml validator w3c css validator