Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ECM2
Systematic Name YBR065C
Alias SLT11
Strain S288c
Description Pre-mRNA splicing factor, facilitates the cooperative formation of U2/U6 helix II in association with stem II in the spliceosome, function may be regulated by Slu7p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECM2 YBR065C
AACTTGATGTCAACTATTCTAGCTAAAGATAGGAAATGTGAATTTCCCATCAATTTCGAA
TGTTCGCCCTCCCAGATAACTCTTATGCCTGAAATGTTCTCTTTTAACAATGAAAGGAAA
TACCAAACCCTGATACCCTTGATGAAAACATCACATCTAATTGATGATGACTTGAAAGAT
AAATTGAATAAGTGCGCTTTCGATTTTTTCTCCGGAAAACAAGCGAACAGAACGAGTGAC
GGGACTATTTCAAGATTAACAGCAAGTGGAAAAACGTCACCGATACTGCCATTGCAAAAT
ATTAATATTGTAAAAGCAGAGAATACCGGTAACGGTAAATCAGATCCATATAGCTCAATT
AAAATAAGCAAACCGACAAAAACCGTGATAAAATTGAAATCTACGAAAACCAATACAGCA
GGACAGAGGACTCGTCATTTCTGTAAGATCTGCTCTACTGGGTTCACCACTTCTGGTCAT
CTTTCAAGACATAACAGAATCCATACAGGTGAAAAAAATCATATCTGTCCGCATGAGGGC
TGTGGACAGAGGTTTAGTAGACATGATAACTGTAATCAGCATTATCGAACTCATGCAAAC
AAGAAGAAAAGAAACTGGAAGAGGAGGGAGGCTAGCAGTTGATGTGAGTGAGCTCAGCCA
AAAACATTTAAATATTCAAATAACGTACAAATAAAAGACTGATAAATAGTAATAAAACTA
AGCGGGTTAGTAATACTCACCAAGAACAATAGCAGGAACGATAGTCGGTTCTCTTTCGTA
ATTTTTTTAAGTCACAACCCGGAGGGACGTGAAGTTTCAAACCTTATTCATTCCGGGATT
ACCCTCTCCTGTGATGACGTTTAGGCAATAAGGACTAAAAAAAAAAAAAAGAAATGCTAT
GGCAAATTTTATTGATAGAAGTGGTAATGATGATGGAAGGGCTTTTGAGCAGGTGAATAG
AAGGTAGCTAACGGAAAAGAGTTATTGCACCCTTAATATA
Chr coordinates Chr II from 369678-368584
w3c xhtml validator w3c css validator