Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIP1
Systematic Name YBR067C
Strain S288c
Description Major cell wall mannoprotein with possible lipase activity; transcription is induced by heat- and cold-shock; member of the Srp1p/Tip1p family of serine-alanine-rich proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIP1 YBR067C
ATGACCTTATTCGTTTCTGTAATTTTATATTTTTTTTACATACATTCATTAATCATCCGT
AGCATACATACCCGCACAATGTCGTTATTGTTTCAAATTTTGCTTTATCCTCCCTTCAAC
AGAACGTGAAGGAGGAATTTCTATGGCTTTGGAAACCGTTCCTATTCTTGCCTATCCCTT
CCAGCGCCTGTCAAACCCCGCCTAAACAGTACTACCTCTTTGGGTAATGGAAAGGATATT
TCACCTTTGAATGGCCAGGTAGGGAAAAAAAGAAAAAAAAACCTTTCTTCTTCTTGGTAT
TTTGACTAGGAGGCCATCATGAAATAGTCACAGAAACAACAAATTTATTGTCTTGGCTTG
CGATCCACATTGATAATTACTTTCTCGGCACTTGCGGCGCACACATGCAGCCGGACGGCA
GCAAGATTTTCAAAACCCAAGCAACCGATACTCAACACAATGGAGCCCAACAAATTGGAG
TAATGACCTTATTGGGTAATCAATATTCCCAAAAAGAGCATCAGACGATCTGGTTATGGT
TTTTCTTGACTATAACCTTAATTATGAGACTAATGTCTTCGGGAGGTCCCTTTTCCGATT
TTCCGACTCTTTTCCGTTGAAGAATGTACTTGTGGTTTTGAATCCTACGGCAGTTATTGC
GGCGGTTTGGCCCTTTCTTTCAAAGATTGTGATGGAAATAATTGATTGTTCCGGGAAATG
TGTCTTATTTTCTAAAAGCATCTTTTTTTCTCTCCAATTCTTCGAGCTATTTCCAGTAAA
GGAAAAAAAAGGTTTGCTGTAAGGGTGAATATGTCTCCAACCTCTTTGAGGTACTGCGTT
GCTTCATTCACCATTTAATATAAATAGTACATTGGCAGCCCTCTTTCAAACGTCAATTAT
TCTCGCTTGCCTAACTTTGTTCGGACCGAAATTATAAAGGCATTCAATCAGTAACAATAA
TTGCTATTGCATAACTATACCCTCTGCTAAATAAAATAAA
Chr coordinates Chr II from 372735-372103
w3c xhtml validator w3c css validator