Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBR071W
Systematic Name YBR071W
Strain S288c
Description Protein of unknown function found in the cytoplasm and bud neck; mRNA expression may be regulated by the cell cycle and/or cell wall stress; overexpression of YBR071W affects endocytic protein trafficking
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YBR071W YBR071W
TTCAACCAAAAGGATATTATACAGCATGTTCCAGGCCCATTCAATAAAAACAGATGAGGG
GAACCACACATAGCAAATCTGATTCTAACCACGTGCACAAAAGATTGTACCAACGTTCCA
ATGATGGTCTTTACACTTTGTAGGAGAGTCGCTTTAACTTCCCTAGCTTTCATGAATTCA
TAGTATTTTACTTTGCAATGACCAAATTTTTTTATAAAGTGGGCGAATCTTTGCCTGGAA
GCCTCATCAGAATAACCCAAGTACACAATCGACTTACCCAGTAAAAGATCCTGGTAATTT
TCTAGAAGACGGATCATTTCACCAGTATGACCTCCCGATCCTAAGAATACAAAAATCTTG
AGCGGTTTCTTTGACGATTTTCGTATTTTCAGTAGGTTAACTCCATCTTTCGTATCCTTT
TCTGTACCTGCTTGAGTGTGGAAAAAAGGCAGAATCGCTATCAACCTAATAACATATGCT
GTCGATACGATGAGCACCAATGACGCCAAGTAGGCCGTTTTCATGATCTTCAAGTCACTT
CTTTCGACTTTCCTGATACAATAATAAACCGCCGATTACAGTTATTGCGGGCCCTTGTAC
ATGAAATATTAGGATGGCTTCGCTAAGAACATTTTTGCTTCTGGACAGACAGAACACGTA
AAAAAAGAAACACGAAATTACGACTAACTTTCGCGTAGGGGTAAAATTACCTAATGCGCG
TAATTAAAAAAAAAAGCACAGCAGTGTAAATTGGAGCAATAGGAGAAAATGACCTGTAAA
GGAAGTATTCGAATTCACTAGTGCGGATATTAATAGAATTCATAATTTCGCGCTTGGCTG
CTCATTATATTCTTGACTATTTGCCAAACTGTTATAAAGAAGCCTCAATATTCGTTTGGT
TTATTGTTAAAGAAGGCGCAAGCTCGGCACGAGAAATATACGACGATAAAGAACATACCA
ACTATATATTGTGACGGCACAAAAAGACAAAATACGTAAA
Chr coordinates Chr II from 380411-381046
w3c xhtml validator w3c css validator