Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP26
Systematic Name YBR072W
Strain S288c
Description Small heat shock protein (sHSP) with chaperone activity; forms hollow, sphere-shaped oligomers that suppress unfolded proteins aggregation; oligomer activation requires heat-induced conformational change; also has mRNA binding activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP26 YBR072W
CGTTGGACTTTTTTTAATATAACCTACCATAGGACACACTTTGTTGTTGATGTTGGACAA
TTCGTTAATTAAGAGTCCCTAAACGGCTCTACTAGTTCCAACCTCACTTTGTTTTTTCAT
TTTTTTATGTTTTTTCTAGAACCTTCTTTACGTGATTCTCGCTCGGAATCCGTCAATAGA
ATGTTTTCAGTCTCCGTTTCAATATTCTGCGCACATCAATCATTTTCTTACTACATACAC
TAACATTACTCCTAGTTTAATTTAATTGAATTTTTAACTTTCTTTTCTTTTCATTTGGCA
ATTTGGCTCCTTGAAAACAAGACTATGGGTCTCTCTCATAAGCCTCAGGGGGGGACCCCA
AAAAAATAACGCGGCCATCTTGCATGCACCGTTGAACCTGTAGCTTACAGTAAGCCACAA
TTCTCTTACCTTCTTGGCAATGTGGCACAAAATAATCTGGTTATGTGTCTTCATTTGGTA
ATCACTGGGATGTTACTGGGGCAGCAGCAACTCCGTGTGTACCCCTAACTCCGTGTGTAC
CCCTAAAGAACCTTGCCTGTCAAGGTGCATTGTTGGATCGGAATAGTAACCGTCTTTACA
TGAACATCCACAACCAACGAAAGTGCTTTTTCAAGCATTGCTTGATTTCTAGAAAGATCG
ATGGTTATTCCCTCCCCCTTATGCGTCCAAAAATATAGGGTGCTCGTAACAGTAAGGTAT
TCGCACTTAGCGTGCTCGCAACACAAAATTAAGTAATATGCGAGTTTTAGATGTCCTTGC
GGATCTATGCACGTTCTTGAGTGGTATTTCATAACAACGGTTCTTTTTCACCCTTATTCC
TAAACATATAAATAGGACCTCCATTAGTTAGAGATCTGTTTTTAATCCATTCACCTTTCA
TTCTACTCTCTTATACTAATAAAACCACCGATAAAGATATATCAGATCTCTATTAAAACA
GGTATCCAAAAAAGCAAACAAACAAACTAAACAAATTAAC
Chr coordinates Chr II from 382030-382674
w3c xhtml validator w3c css validator