Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TEC1
Systematic Name YBR083W
Alias ROC1
Strain S288c
Description Transcription factor required for full Ty1 expression, Ty1-mediated gene activation, and haploid invasive and diploid pseudohyphal growth; TEA/ATTS DNA-binding domain family member
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TEC1 YBR083W
CCTGGCAAGGTTAAGCCAAGTGGTGTAGTTACCAGAAAAAAGTGAACACATACAAGATAC
GATGCGTAAGTACATAAGGTATGACAGCCTGTAACAAATCCACGTTAGATTTATATCTTC
TAGGCTGAGAATCTGGCAGGTTTTAGCAAAACATATATAACTTGCTCTCATTAAGCGGGC
TCACTGCTTAAGCGATTGTTACCTGGAACTACAGGCAAGTACAATAGCCTCCTCCAGCTT
TTGACTCTGAAAAAAAGGTAACGAAAGAAACTTTTCACACAGATAGGAACTATTCTAATA
TTACAGTAAAGCCAGCTATGGAATAACAGGTGGCATGTGCCCACTGTATTCATGTATGAG
CGGCCTTTTTTTTCCACGAAAACAGATATGATGATGTTTTAGGCCAAAATGGTGAGATCC
TTTTACAGGAAGATTTTACGCCAACTCTTTCCATTTAGTGACACAGGTGAGGGTCTTTTA
TCGGCGCAAGGTGTTTCAGATGAGCCATTTTGCCCGTAGTCCGGTTTAATCAGCCTCATT
GGAATTCCCCGGCACCGCTCGCATTCCGCGTACGACTCAAAGAATTTCCCATTGAATTCG
GGAATGTGCGTGTTTCAGATTGCGTTTGCTTATTATTCTGGGAAACTCTCCGGAAACAAG
CTGAGCTGGACTCCACGAATGGTCCCTCACAAGGCTCTTGGCTCATGCACAGTTAAAAAG
CACCTGTAGCTACCATCAGCAATCCATGGTGCTGGAGTTTCTCTCGATGGTACGGCCCAT
AGCTGGAGAAAATAGCTTATTACCAAAAAAGTAATTCCCCCGCAGAGGTATATATTAAGT
TTGAAACAAAAGGCTTGCTTAATTTTTTACATATGACAACCCTTTTCTTACTTTTATAAA
TGTTTATGAAACAGGAGATTCTTCGACTGGTGCCAGATTCCTCCCATATCGACAAGAAGA
ATAATCCACCTATTTCAACAATTCTGATACCTGTTTAACC
Chr coordinates Chr II from 409169-410629
w3c xhtml validator w3c css validator