Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO3
Systematic Name YBR092C
Alias phoC
Strain S288c
Description Constitutively expressed acid phosphatase similar to Pho5p; brought to the cell surface by transport vesicles; hydrolyzes thiamin phosphates in the periplasmic space, increasing cellular thiamin uptake; expression is repressed by thiamin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO3 YBR092C
TAGTCCATTACTCCTACTACCAAGACTTGCACACTTATTACCATGAGGGTCCAGGTTACG
ACATTATCAAGTCTGTCGGTTCCAACTTGTTCAATGCCTCAGTCAAATTATTAAAGCAAA
GTGAGATTCAAGACCAAAAGGTTTGGTTGAGTTTTACCCACGATACCGATATCCTAAACT
TTTTGACCACCGCTGGTATAATTGACGACAAAAACAACTTAACTGCCGAATACGTTCCAT
TCATGGGCAACACTTTCCACAGATCCTGGTACGTTCCTCAAGGTGCTCGTGTCTACACCG
AAAAATTCCAATGTTCTAACGACACCTACGTCAGATACGTCATTAACGATGCTGTTGTTC
CAATTGAAACCTGTTCCACTGGTCCAGGGTTCTCTTGTGAAATCAATGACTTCTACGACT
ATGCTGAAAAGAGAGTAGCCGGTACTGACTTCCTAAAGGTCTGTAACGTCAGCAGCGTCA
GTAACTCTACTGAATTGACCTTCTACTGGGACTGGAACACTACTCATTACAACGCCAGTC
TATTGAGACAATAGTTTTGTATAACTAAATAATATTGGAAACTAAATACGAATACCCAAA
TTTTTTATCTAAATTTTGCCGAAAGATTAAAATCTGCAGAGATATCCGAAACAGGTAAAT
GGATGTTTCAATCCCTGTAGTCAGTCAGGAACCCATATTATATTACAGTATTAGTCGCCG
CTTAGGCACGCCTTTAATTAGCAAAATCAAACCTTAAGTGCATATGCCGTATAAGGGAAA
CTCAAAGAACTGGCATCGCAAAAATGAAAAAAAGGAAGAGTGAAAAAAAAAAAATTCAAA
AGAAATTTACTAAATAATACCAGTTTGGGAAATAGTAAACAGCTTTGAGTAGTCCTATGC
AACATATATAAGTGCTTAAATTTGCTGGATGGAAGTCAATTATGCCTTGATTATCATAAA
AAAAATACTACAGTAAAGAAAGGGCCATTCCAAATTACCT
Chr coordinates Chr II from 429101-427698
w3c xhtml validator w3c css validator