Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO5
Systematic Name YBR093C
Alias phoE
Strain S288c
Description Repressible acid phosphatase (1 of 3) that also mediates extracellular nucleotide-derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO5 YBR093C
TAAATACAATGTTCCTTGGTTATCCCATCGCCAATAATTTTTATTTTTACCACTGTTGAA
GAAGCGAAAGAAAAAAAAAGGGAAAATCAAAACATTCCCTGTGCACTAATAGAAGAAAAC
AAGAGACTCCGTCCCTCTTTAGTGAGAAAATTGACCAGAGATGGTTTTTGTCCATCTTTT
CGCAAAAAATTAGTTCTATTTTTTACACATCGGACTGATAAGTTACTACTGCACATTGGC
ATTAGCTAGGAGGGCATCCAAGTAATAATTGCGAGAAACGTGACCCAACTTTGTTGTAGG
TCCGCTCCTTCTAATAATCGCTTGTATCTCTACATATGTTCTATTTACTGACCGAAAGTA
GCTCGCTACAATAATAATGTTGACCTGATGTCAGTCCCCACGCTAATAGCGGCGTGTCGC
ACGCTCTCTTTACAGGACGCCGGAGACCGGCATTACAAGGATCCGAAAGTTGTATTCAAC
AAGAATGCGCAAATATGTCAACGTATTTGGAAGTCATCTTATGTGCGCTGCTTTAATGTT
TTCTCATGTAAGCGGACGTCGTCTATAAACTTCAAACGAAGGTAAAAGGTTCATAGCGCT
TTTTCTTTGTCTGCACAAAGAAATATATATTAAATTAGCACGTTTTCGCATAGAACGCAA
CTGCACAATGCCAAAAAAAGTAAAAGTGATTAAAAGAGTTAATTGAATAGGCAATCTCTA
AATGAATCGATACAACCTTGGCACTCACACGTGGGACTAGCACAGACTAAATTTATGATT
CTGGTCCCTGTTTTCGAAGAGATCGCACATGCCAAATTATCAAATTGGTCACCTTACTTG
GCAAGGCATATACCCATTTGGGATAAGGGTAAACATCTTTGAATTGTCGAAATGAAACGT
ATATAAGCGCTGATGTTTTGCTAAGTCGAGGTTAGTATGGCTTCATCTCTCATGAGAATA
AGAACAACAACAAATAGAGCAAGCAAATTCGAGATTACCA
Chr coordinates Chr II from 430951-429548
w3c xhtml validator w3c css validator