Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO5
Systematic Name YBR093C
Alias phoE
Strain S288c
Description Repressible acid phosphatase; 1 of 3 repressible acid phosphatases that also mediates extracellular nucleotide-derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO5 YBR093C
TAAATACAATGTTCCTTGGTTATCCCATCGCCAATAATTTTTATTTTTACCACTGTTGAA
GAAGCGAAAGAAAAAAAAAGGGAAAATCAAAACATTCCCTGTGCACTAATAGAAGAAAAC
AAGAGACTCCGTCCCTCTTTAGTGAGAAAATTGACCAGAGATGGTTTTTGTCCATCTTTT
CGCAAAAAATTAGTTCTATTTTTTACACATCGGACTGATAAGTTACTACTGCACATTGGC
ATTAGCTAGGAGGGCATCCAAGTAATAATTGCGAGAAACGTGACCCAACTTTGTTGTAGG
TCCGCTCCTTCTAATAATCGCTTGTATCTCTACATATGTTCTATTTACTGACCGAAAGTA
GCTCGCTACAATAATAATGTTGACCTGATGTCAGTCCCCACGCTAATAGCGGCGTGTCGC
ACGCTCTCTTTACAGGACGCCGGAGACCGGCATTACAAGGATCCGAAAGTTGTATTCAAC
AAGAATGCGCAAATATGTCAACGTATTTGGAAGTCATCTTATGTGCGCTGCTTTAATGTT
TTCTCATGTAAGCGGACGTCGTCTATAAACTTCAAACGAAGGTAAAAGGTTCATAGCGCT
TTTTCTTTGTCTGCACAAAGAAATATATATTAAATTAGCACGTTTTCGCATAGAACGCAA
CTGCACAATGCCAAAAAAAGTAAAAGTGATTAAAAGAGTTAATTGAATAGGCAATCTCTA
AATGAATCGATACAACCTTGGCACTCACACGTGGGACTAGCACAGACTAAATTTATGATT
CTGGTCCCTGTTTTCGAAGAGATCGCACATGCCAAATTATCAAATTGGTCACCTTACTTG
GCAAGGCATATACCCATTTGGGATAAGGGTAAACATCTTTGAATTGTCGAAATGAAACGT
ATATAAGCGCTGATGTTTTGCTAAGTCGAGGTTAGTATGGCTTCATCTCTCATGAGAATA
AGAACAACAACAAATAGAGCAAGCAAATTCGAGATTACCA
Chr coordinates Chr II from 430951-429548
w3c xhtml validator w3c css validator