Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FES1
Systematic Name YBR101C
Strain S288c
Description Hsp70 (Ssa1p) nucleotide exchange factor, cytosolic homolog of Sil1p, which is the nucleotide exchange factor for BiP (Kar2p) in the endoplasmic reticulum
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FES1 YBR101C
ATATTGAATTAGCTAGGCTTAGGTTTGAAAGTGCCGTGGAAACATTATTGGATATTGAAT
CACAATTGGAGGATCTTTCTGAAAGAATTTCTGATGAAGAGTTAATGTTACTTAACCTGA
TATCTTTAAAAATCGAACAAAGAAGAGAGGCCATTTCTAGCAAACTTTCTCAGAGCATTT
TATCATCGAATGAAATAGTGCATTTGAAAAGCGGTACTGAAAATATGATTAAGTTAGGAT
TACCAGAGCAAGCTCTTGACCTATTCTTACAGAATAGATCTAATTTCATTCAAGATTTGA
TTCTACAGATTGGATCAGTGGACAATCCTACGAACTATTTGACTCAATTGGCTGTTATCA
GGTTCCAAACCATTAAAAAAACAGTGGAGGACTTCCAGGATATTTTCAAAGAACTCGGGG
CTAAGATTTCTTCCATCCTAGTAGATTGGTGTAGCGACGAAGTGGATAATCACTTCAAAT
TGATAGACAAGCAATTACTGAATGATGAAATGTTATCCCCAGGGTCCATTAAGTCATCCA
GAAAACAGATAGATGGATTGAAGGCCGTAGGTTTGGATTTTGTCTACAAATTGGACGAGT
TTATCAAAAAGAACAGTGATAAAATTCGCTAAACAAGATCACAGAAAATAAACCTCACTT
CAATATATATGATGTGTAGGTAGGGTATATACTTATACCACTGCTGTCGACAGTGTACTA
ACCTATTTCCTATTTTGTAGGTAAGCTTTTCAGCTACTGGTTGGTCAAGTTGGGCCCTAT
TAAGGTTGTAATCAGCTTATTCGTTTGAAATGATATACCTCTTGGACTGGAATCTTCTGG
AAGTTTTTTGGAGGTTAGAAAAGAGGAAGGCATCTCGCGCTGACAGAAATTTGCTTATAA
ACCAGCGATTGGCTATATCTAAAAGAGCACTCATCGTCAGTCAGAAAGCCATTACCTTTC
AACGAAAGAGTAAAATAGAAAAAAAAACACATACATAACT
Chr coordinates Chr II from 444693-443821
w3c xhtml validator w3c css validator