Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VID24
Systematic Name YBR105C
Alias GID4
Strain S288c
Description GID Complex regulatory subunit; binds GID Complex in response to glucose through interactions with complex member Vid28p; regulates fructose-1,6-bisphosphatase (FBPase) targeting to the vacuole; promotes proteasome-dependent catabolite degradation of FBPase; peripheral membrane protein located at Vid (vacuole import and degradation) vesicles
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VID24 YBR105C
AGCCATACCAGTGTAGATAGACTTGATAGCACTGTCTATTTCCTTCAAATCGTAGTCTCT
GACGGTAGTAACTTGCAGCTTCTCACCTTCGCCGGACATAGCATTACCAGGTTCGACGTA
CTTCATGGTAGTCATGTCGTTTTTAGCAACAATTCTCTTTCTGGCCATTTGGTAGATGAT
CCAAGAGATACCGATGGAAGAACAGTATAAAATTCTAATGTACATGATGATGGTTGGGTC
CTCCATGTCAATGCGACGGGAGAGTTGCATCATGACCAACATGATGATGATGTTACTGAC
TTGAGGATTCATGGCGGGCTGCTCGGTTCTCTTGTGCTGTGTTATACTGTTATAGTTTCT
AGCTTCTAATGTAAGATAACAGTGAGCGTTCTTATATGTATATCGAATGAAAGAGCAAGG
CAACTACATTTTATAAGCGTTTCGGTTTTGGCGCGTTTGGCCACCGGCCGCCAAAAAAGA
AAGAAAAAGAGAAGGCAGTGGCAAACGTCGAAGATATGAAAAAAAAAAAAAAAAGAATTA
TGGGCGTGCGATCCGTGTAAAGTGATGTTCTTCTTCTTTCATAATTTCAGCCGTTCAGAA
CGATATCTAAGGCAGGCGAGGGATTATCCGATTTGTTCCGGTGACCCCTCCCCCACCCCG
CGGGGCAGGCGGGTTTTAATTTTCGTTTTTTTTTTCTTTTCCGGAAAAACTCGCAGGGCA
AAAGAAACGGAGGGAGGTGTGCGGCTTTCTCTAGTGTAATTGCCTGTTATAATGACAAAC
CGCGAGGATAATAGCGGTTTATTTCTTTTTCTGCATACCATATCATTTTCTTTTTCTGCA
TCTTCTACAAAAGTTGAAATTTATATATACAGTCTTTTTGACTTTCAACTCATCCCGGAT
TTTGGTTTTCTTCGTCTTGGAAGATTAGTTCACTTTCTTTTCTGTTCTATCATTTGTGGC
GTCTTGTGCATGACACCAACACATATCGCAAGCTTGAGTC
Chr coordinates Chr II from 451969-450881
w3c xhtml validator w3c css validator