Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AIM3
Systematic Name YBR108W
Strain S288c
Description Protein interacting with Rvs167p; null mutant is viable and displays elevated frequency of mitochondrial genome loss
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AIM3 YBR108W
GTACAACTGCTAGAACTCTGTTCCTGAGACTTCGTGTTGAAGTGACAATGGATTCTCTCA
TTATTTTCGTGTGCCCTGCCAATATGACGGAAGTCAACGGTAATCTTTCCACCGCCATCC
CCGTTTCATTATAAATGTAGGGTACAATTGCATCGTTATACGGGTGCATAGTATTACCAT
AGCCAAGAGCCAAACCCTCACAGCTTTCTCTCGGTATTTCTATACTGAATTGCCGCAAGT
TTTTGTCTTGTGTTTCTGGTTCAAAATATAACTTTGAGCTAAACCAGGTAATTTGTTCGA
TGTTCTCTTTCGTTACGTGCACAATGCTGGCGTCAGCTAACTTTATCATGGTCTTCTGTT
CAAATTTTATCGGCCACATAATGACACCGTACTCTGCCTTCAGCCACTGCAATACCACTT
CATTGCGGTTATCTGTCCCGCAATAGCACAAAAACATCGGCACCTCCATTTTTGAGTTCC
CCAAGAAAATGAACTTAGAGTAAGTGCCCTCATCTAAATTAGAGATGTCCAACCTCATTT
CGTAACGGATATACTCGTCAGCGGCGGTACCACCATCAGGATCACTGGGTACTCGAATGG
TTTGAATGTCTAAATCTACTTCCAGGTTTAGCAATTGGTTCAACTTTGCTATACCATTTT
CCAGTGAAAGTTGCTTGCTGATTCCTAAAAACTTCCAAGTATAAGGCATTCCATCCAAAG
GAAGTACGTTGATACCTATAGACAATCAAATCAACCATGCAGTCGACCAGATCATCCCAC
TATGGTTGTTGTCTATTTCATATCGGTGTCGGCATTTTTTTTTCCCGTAGTACCACTGGA
TCTGCCTAAATCGCGCTTCAGGAAAACCAGGGACCACCCTATTTTTTTATATTTCATCAT
CTAAATTAAGTGTATACATATATGGATAAAGTCATTTTGAGTTTACATAATCGTATGTTC
GAGAGAGGTCTTTCATAAAAAAATCAAGTTATCAACCAGC
Chr coordinates Chr II from 454822-457665
w3c xhtml validator w3c css validator