Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LYS2
Systematic Name YBR115C
Strain S288c
Description Alpha aminoadipate reductase, catalyzes the reduction of alpha-aminoadipate to alpha-aminoadipate 6-semialdehyde, which is the fifth step in biosynthesis of lysine; activation requires posttranslational phosphopantetheinylation by Lys5p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LYS2 YBR115C
TAACGAAACTTCTGCTGCGTATTATTCTGCTATCAAATCTGGTCGAACACCATCTGTTGT
GGCTTTATCACGACAGAATCTTCCTCAATTGGAGCATTCCTCTTTTGAAAAAGCCTTGAA
GGGTGGCTATGTGATCCATGACGTGGAGAATCCTGATATTATCCTGGTGTCAACAGGATC
AGAAGTCTCCATTTCTATAGATGCAGCCAAAAAATTGTACGATACTAAAAAAATCAAAGC
AAGAGTTGTTTCCCTGCCAGACTTTTATACTTTTGACAGGCAAAGTGAAGAATACAGATT
CTCTGTTCTACCAGACGGTGTTCCGATCATGTCCTTTGAAGTATTGGCTACTTCAAGCTG
GGGTAAGTATGCTCATCAATCGTTCGGACTCGACGAATTTGGTCGTTCAGGCAAGGGGCC
TGAAATTTACAAATTGTTCGATTTCACAGCGGACGGTGTTGCGTCAAGGGCTGAAAAGAC
AATCAATTACTACAAAGGAAAGCAGTTGCTTTCTCCTATGGGAAGAGCTTTCTAAGTCTG
AAGAAGTAAACAGTTCTTTGCTATTTCACACTTCCTGGTTGATGGTCACTTGCTGCCTGA
AATATATATATATGTATGACATATGTACTTGTTTTCTTTTTTGTGCCTTTGTTACGTCTA
TATTCATTGAAACTGATTATTCGATTTTCTTCTTGCTGACCGCTTCTAGAGGCATCGCAC
AGTTTTAGCGAGGAAAACTCTTCAATAGTTTTGCCAGCGGAATTCCACTTGCAATTACAT
AAAAAATTCCGGCGGTTTTTCGCGTGTGACTCAATGTCGAAATACCTGCCTAATGAACAT
GAACATCGCCCAAATGTATTTGAAGACCCGCTGGGAGAAGTTCAAGATATATAAGTAACA
AGCAGCCAATAGTATAAAAAAAAATCTGAGTTTATTACCTTTCCTGGAATTTCAGTGAAA
AACTGCTAATTATAGAGAGATATCACAGAGTTACTCACTA
Chr coordinates Chr II from 473926-469748
w3c xhtml validator w3c css validator