Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TKL2
Systematic Name YBR117C
Strain S288c
Description Transketolase; catalyzes conversion of xylulose-5-phosphate and ribose-5-phosphate to sedoheptulose-7-phosphate and glyceraldehyde-3-phosphate in the pentose phosphate pathway; needed for synthesis of aromatic amino acids; TKL2 has a paralog, TKL1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TKL2 YBR117C
TATAGTTAACTACCGGCTCGATCATCTCTGCCTCCAGCATAGTCGAAGAAGAATTTTTTT
TTTCTTGAGGCTTCTGTCAGCAACTCGTATTTTTTCTTTCTTTTTTGGTGAGCCTAAAAA
GTTCCCACGTTCTCTTGTACGACGCCGTCACAAACAACCTTATGGGTAATTTGTCGCGGT
CTGGGTGTATAAATGTGTGGGTGCAACATGAATGTACGGAGGTAGTTTGCTGATTGGCGG
TCTATAGATACCTTGGTTATGGCGCCCTCACAGCCGGCAGGGGAAGCGCCTACGCTTGAC
ATCTACTATATGTAAGTATACGGCCCCATATATATATATATATATATACATTAAACATTA
TTGGTAAATACACCAGCAACCGCATGATTGATGTTATGGTGGAATATAGGTAGCTAAAAA
AACTCTACATAACAAAGTAATTGTTTACATTGATCTTGACCTATCAAATTTCTTTCACAT
TTTGGGTTTATAGGTCAATATATTGATATATATGTGTAGCTATTTTCGCTTGCTTTCAAG
TCACTTCTTAATGGTGGCTCGCTGTCTCTCCTTTGCTAGGGACAAAAATTCGCCTTTAAT
GGCACATATGCCATGCTTTGAACAGGGAACACGATATATAACGTCATTGCTCGGACATGT
TTGGGTGGACCTTATTCTACATGTTTTACTTTTCTCGTCATAATGGCGATGACAGGAAGG
GCAAGCTCATCTCCCCAGCTTTAAAGGGTAGCTCAAGGAACACCTACTTCTCCTTGTTGG
GAGGAGTCCTGAATAAGGAGTGTCGAATATAGGGAGCTTCATTCGTTGTCAAGAGAATAC
CAGATCACCTGTTTGGATATATAAACGAGTGTAATAATGCAGAATTATTCCATTTATTTC
AGTCGTATATTCAATTGGCTTGTCCCCTCTTACTGTAGTCTTCGATTTGTAACCTCTACG
TAGACGATTATACCTTACTAATCAAAAAAAGAACAAAAAA
Chr coordinates Chr II from 476437-474392
w3c xhtml validator w3c css validator