Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG14
Systematic Name YBR128C
Alias APG14, CVT12
Strain S288c
Description Autophagy-specific subunit of phosphatidylinositol 3-kinase complex I (with Vps34/15/30p); Atg14p targets complex I to the phagophore assembly site (PAS); required for localizing additional ATG proteins to the PAS; homolog of human Barkor
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG14 YBR128C
GAGGAAAAACCAATTTGCCTATTACAAAACTCGGGATGAAAGAGAGGCTATAAGTGTCAT
ACCGAGATTTGACATACTTAATTTTAAGATAAGCGAGCTCGATGGTATATTAACTGTTTA
TACTCCATCCAAGGATTTAATATTCAAATTTCCACGAGGGCAAAATGAGAAGGTTGGTAT
GGAACTGATGCATAATTGGAAAATTGCCCTTGAAAAATTCCTCTCTAGTCCTAGTGGCAA
CGAAAGTGTCACTACAGGTAGTGATTATGATGAAGAAGAGGATGATGATGATTTAATTGT
AGTTGACGAAAAGGCGGGTCCTTCTAGCAGCAAGCATTCTTGCAGTTTGACGATGGATGA
GCAACTGTCTCGTGAAGATAAAGAATTTTATAGGATGTTCGATCCAAGAAATGCAGAGCA
CCAGGTTTGTTCTGGGATTCTTTACACAAAAGTGAAAAAGAAGAAACTGTTCAATAGGGC
TAAATGGCAAAAGTTCAATGTGGAATTGACTAATACTTCGTTCAATTTATACTCTTTCAA
GACTGGGAAGTTAAAGAAAAGCATTAAATTGGATAAAATTATCGATTGTATTGAACTTGA
TAATAATTCGAAGATGAAAAATGACGACACTAATTTTGCGCTAATTACATTTGATGAAAG
GTTATCTTTTAAAGCCGCTAACGATCAAGATATGGTGGATTGGATAATAAATTTCAAGAG
TGGAATTTTGATAAGAAAAAAATTAAAGGCCGAAAATATATAAGCAATGCCAATGATGAA
TATGTATTGACTTTTTTTTTCTTTGTACTATTAAATAATACGTGTAATTGTTTTCCTTAC
GTCTAGTTAAAAAACTATTTATTTATTTGTATTTTAATGATAATAAGCACTTTTTTCCTC
GCTGAAAATTAAGGGAAAGGACCAAATACAAAAGTGATTAGAAGGATAACGAGTAGAGAA
AAAGGGAAGTAAAAGTTAAAAACTAGAATCCTAGTATGAC
Chr coordinates Chr II from 494115-493081
w3c xhtml validator w3c css validator