Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OPY1
Systematic Name YBR129C
Strain S288c
Description Protein of unknown function, overproduction blocks cell cycle arrest in the presence of mating pheromone; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OPY1 YBR129C
CAAATTAAATGAAAAAATCGGTTTGTTGGAGTTAGAGTTAAGTAATCAAAATTTAAATTA
TGGTTCAGATACTAGTTCAAATTCAGATATAGAATTGAATTTAAATAAATTCAATGACTC
TGTGAAAGATTTGAAATCTCTGGAAACAGAAAAGGATTCAAAATTAAGCAAGATAATCAC
TCACTCTTTAGATGAGTTAAATCTACAAAGCTGGCTAAATCTGTACCAGACGAACGAAAA
TCTGATATCAACTTTTGCTGAAAAGATGGATTTGAAAGACGTCTTGAAAAGAAACGATGA
GAAGATTAGTAATAAAGGCGCGGTAGTACAAACCTTGAAGAAGAATGTACAAACCCAGGT
GGAAAGCAACAACGCTGACGCTTTGAGTAGCAATAATGCACAGGATATGCTTCCTATTAA
GATGGTCAAATTAAGAAAGACGCCGAACACAAACGATTCATCCTCCAATGGTAATAGCAG
TAACAATAAAAGAAGAAGTTTCTATACTGCGTCGCCTTTGCTGTCATCGGGTTCTATTCC
AAAATCTGCATCCCCGGTTTTGCCTGGTGTTAAAAGAACTGCCTCAGTAAGAAAACCAAG
CTCGAGCAGTAGTAAAACAAATGTAACGCATAATAACGATCCAAGTACATCTCCCACAAT
CTCAGTGCCTCCCGGTGTTACAAGAACTGTTTCCTCCACTCATAAGAAAAAGGGAAATAG
TATGGTTGTTCACGGGGCCCAATCCTAGAATATGCCGACACAAGGGAGTATATATATAGG
ATTCATTTAGATAATAGAACAAAAGTAAATAGATGCCTCTAAGGTTTTATAGACACGAAT
CCATATTTTTCACTTTCGGTCACTCACAACGGTTTTTTCTCTACTATAATGTGGCTGAAA
TTAAACGAACAGGCCAAAATGTGGTACGCAATAGTAGCCAGTAGGTGAATTAACCATAAA
TAATTACGCTAATTTTGCCTTGGTAAATTTCATAAGACCA
Chr coordinates Chr II from 495339-494353
w3c xhtml validator w3c css validator