Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AGP2
Systematic Name YBR132C
Strain S288c
Description High affinity polyamine permease, preferentially uses spermidine over putrescine; expression is down-regulated by osmotic stress; plasma membrane carnitine transporter, also functions as a low-affinity amino acid permease
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AGP2 YBR132C
ATGAATACCAGACGAGAAGAAAATCTAATCAAGAAATGTGACCATACACCAAATATGACC
TCGTGGTCTCCAATTATCTTTCCTTTGAAGCAACCAATATCCTTTATAGATGACTCCGAA
CTTTCTGTGCTGATGTCTCGGATACACTCCGATACAGAACAAAAAGTTTGGTATGAATGG
TCTTTGGAGAGTTTCATATACCTTATGTTGTCAAATTACACTTCGGCGGTAACTGCTGCA
AGCATGACTATTCCGAGGTCTATAGTTACAGATGACACTAAAACTTTAGCCCATAATCGA
CATTATTCAGCGACTACCAATCAAAAGCTAGATAATCAAATTGATCTTGACCAAGACATT
GAAAACGAAGAAGAACAGGGATTCCTATCCAATCTAGAAACTGGTTGGCAAAGCGTACAA
GATATTCACGGACTCAGCGAAACCGCCAAACCGGACCATTTAGATTCTATCAATAAGCCT
ATGTTTGATCTCAAATCTACTAAAGCGCTTGAACCCTCTAACGAATTGCCAAGGCACGAA
GACCTCGAGGAAGATGTTCCAGAAGTTCATGTCAGAGTCAAGACTAGTGTTTCCACGCTA
CATAATGTCTGTGGCAGAGCCTTTTCCCTGCCTCTGTGAATTCTGCATTGTATACTATAT
ACTGCGGCAACAAATAACTATCCATACGTCCTGAGTACCACAAGTCAGCGTCATCGATCG
AGCGGGGTGTCGGCGCCGCACCGTAAAACTACATGTATAAAAAAAGAACCCTTTTTTTGG
AACTCTTCAATGGTAAATGGATCTCGACATGTTGCCTGCTTTAATTTATGTAATTCAGGA
GTAAGGGTAGTGTTAGTTCACCATACTTCGTATTGATATTATCTCGGTTAGCTCCTTTGC
TTTAAGATACTAATAGGTGGTAATTAAAAACAATAGTTTTCCTTCAGCCTTGTCCCCCCT
AAGCTGCACTTACATTTTGCTTCCATAACTTTTGCCAAGC
Chr coordinates Chr II from 501442-499652
w3c xhtml validator w3c css validator