Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CKS1
Systematic Name YBR135W
Strain S288c
Description Cyclin-dependent protein kinase regulatory subunit and adaptor; modulates proteolysis of M-phase targets through interactions with the proteasome; role in transcriptional regulation, recruiting proteasomal subunits to target gene promoters
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CKS1 YBR135W
GGCGCCAATATTAGCTTATTGATTCCAACAAACCTCGCGTACTTACATTCGTTTAGAAGG
ACCTTTAAGCCAAGATCTCTTACATTTGGATCGCGACTCTCCAGCTCCAGCCAAGAGGAT
AACAGCCCTATGTAAGACGGCGTATCGTCATTGTCTAGCTTCTTGACGTTGAACGGGGGT
ATACAGATATCCTGCAACTGCGGTTCAGGAATTTGAAGCGGTTTCCAGTTCTGTATGGAT
TGTCTTTGGAAATCTTTGAAAACTTGCCCAACTATTTCCTTATATCTTGGCGTTGTTATA
GGAAGCAAAACGTAATCATAGTTACTAGGCAGTTCTGGTGAATGACTAGAGACATTTTCT
AGGAAACGTGACTTTTTGCTGTGCTGTTTATGATTAAAGCCTGGTTTGACACCAACAAAT
ACGTTGCTATGCATATGCAAACTGAACCCTTTGTATATATAAAAATTATATGTATAAAAG
AAGAGGAACGTCCGCACAATTCCACACACACACACACACACACGCTTTCACACACGCAAT
TTGAAATAGCTCCTATAGGGCTTGGGAATAGGATCACAAGTCACTCGAAATATACCATTT
TTTCTATCACACATACACATTGTATAAAGCCATTTGTTTCAAAAAAATATAAAAACACTG
CGCAGCGTGCTGTTTCGGGTTCCATTTGTGATTGTTTATTTTTCTTTTGGTTTAGCTCAG
TGCAAAACGAGGGCTCGAAGAATTTTCAGATAAAACAGTACTCGAGCCCTGAGATCTGTT
TTAGGGTCTAAAAGGCGGGTTATAAAAATATGTCAGGTGATTTTTTTTTCTCGTGGTATG
AGATAAATAAAGAATGGAGCTTTTATGCATGAAAGGACAGCGGATGGCAGTAGAGCAGAC
ATCAGTAGCATTCATTACAACTCTGTCGTAAGTTCTTGGAACTGCTGGCCGCGTTGGATA
CAACTAGATTGACACGCACTTACTCTCGTCTTACAGTACT
Chr coordinates Chr II from 504854-505306
w3c xhtml validator w3c css validator