Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CKS1
Systematic Name YBR135W
Strain S288c
Description Cyclin-dependent protein kinase regulatory subunit and adaptor; interacts with Cdc28p (aka Cdk1p); required for G1/S and G2/M phase transitions and budding; mediates phosphorylation and degradation of Sic1p; modulates proteolysis of M-phase targets through interactions with the proteasome; role in transcriptional regulation, recruiting proteasomal subunits to target gene promoters; human homologs CKS1B and CKS2 can each complement yeast cks1 null mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CKS1 YBR135W
GGCGCCAATATTAGCTTATTGATTCCAACAAACCTCGCGTACTTACATTCGTTTAGAAGG
ACCTTTAAGCCAAGATCTCTTACATTTGGATCGCGACTCTCCAGCTCCAGCCAAGAGGAT
AACAGCCCTATGTAAGACGGCGTATCGTCATTGTCTAGCTTCTTGACGTTGAACGGGGGT
ATACAGATATCCTGCAACTGCGGTTCAGGAATTTGAAGCGGTTTCCAGTTCTGTATGGAT
TGTCTTTGGAAATCTTTGAAAACTTGCCCAACTATTTCCTTATATCTTGGCGTTGTTATA
GGAAGCAAAACGTAATCATAGTTACTAGGCAGTTCTGGTGAATGACTAGAGACATTTTCT
AGGAAACGTGACTTTTTGCTGTGCTGTTTATGATTAAAGCCTGGTTTGACACCAACAAAT
ACGTTGCTATGCATATGCAAACTGAACCCTTTGTATATATAAAAATTATATGTATAAAAG
AAGAGGAACGTCCGCACAATTCCACACACACACACACACACACGCTTTCACACACGCAAT
TTGAAATAGCTCCTATAGGGCTTGGGAATAGGATCACAAGTCACTCGAAATATACCATTT
TTTCTATCACACATACACATTGTATAAAGCCATTTGTTTCAAAAAAATATAAAAACACTG
CGCAGCGTGCTGTTTCGGGTTCCATTTGTGATTGTTTATTTTTCTTTTGGTTTAGCTCAG
TGCAAAACGAGGGCTCGAAGAATTTTCAGATAAAACAGTACTCGAGCCCTGAGATCTGTT
TTAGGGTCTAAAAGGCGGGTTATAAAAATATGTCAGGTGATTTTTTTTTCTCGTGGTATG
AGATAAATAAAGAATGGAGCTTTTATGCATGAAAGGACAGCGGATGGCAGTAGAGCAGAC
ATCAGTAGCATTCATTACAACTCTGTCGTAAGTTCTTGGAACTGCTGGCCGCGTTGGATA
CAACTAGATTGACACGCACTTACTCTCGTCTTACAGTACT
Chr coordinates Chr II from 504854-505306
w3c xhtml validator w3c css validator