Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YBR144C
Systematic Name YBR144C
Strain S288c
Description Putative protein of unknown function; conserved across S. cerevisiae strains; YBR144C is not an essential gene
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>YBR144C YBR144C
ATGCTTTTTGACTCATCCTTCCGCGAAAGGAGAACTTTTTACAATGCCGCCGGCTCTGTT
AGCGTACCCTTCTACAAGCAGATAGCAGAACAAACACATGATATATTCAAAAGGTGCAAT
GTCAGAGAACATATATTGCGCCCCTGTCCTGTAGACATCAGTCATTTTTCGCGGGACTTG
AATGGCGCACCATTATCCTATACAGAAAACATTAAATTTACTGCAAAATTTTGGGCAAAC
GCTTGGATAGACTATGAATCCGTCATGAAGACACTACTTGTAAAATTATATATATCCTTT
TTTTTCATGTGCTAG
Promoter Sequence
Download FASTA
>YBR144C YBR144C
CAATACCTCGTAGAAGCCTCGATAGCTGCTTCAGAAACAGACACATTAATAACTCCATGA
GAACCGCCATTAGTGGCCTTTATTATAGCACCAACAATGTCTTTTTCTTCCGTGAAATCG
ATGAATATTTCTCCGCCTAATTGTTCAAATAACTTTCGCTTGGCATTACCACCATCGATA
CCAATGACCCTGTAACCCATAGCAAGGGCGTATTGGATTGCCAGAGAACCCAAGCCACCG
CATGCACCGGATATAGTGACCCATTGGCCTGGTATCACATTGGCTCTTTTCAACGCCTTA
TAAACAGTGATACCTGCACACAAGATTGGGGCAACTTCAGCAAGATTGACGTTTGGTGGA
ATATGGGCAGCTTGAACGGCATCGGCAGTTGCGTATTCTTGAAAAGTACCATCATGTGTG
AAGCCAGTACCATCCAAATAAGGACATTGAGATTCATTACCTACTTCACAATATTCACAG
GACATGCAAGTCCCATTCAACCATTTTATACCTGCAAAATCACCGACTTTCCAGCCCTTA
ACGTTAGATCCCAACTTAACAACAACACCAGCACCTTCGTGACCACCGATTAATGGAAAT
TTCAATTGAAATGGCCAATCACCGTGCCACGCGTGCAAGTCACTATGACAAACACCAGAA
TATTTAACGTGGACTAAAATTTCGTTAGGCTTAGGTTCCGGAACTGTGACGTCTTTATAT
TCCAATTTTCCATCTGTCTCATAAAAGACAATAGCCTTTTGTTTTTCAGGAATGACTTGC
GAAGGCATGATGCTTTGATTTTGTAGATATGTAGTTAAATAATTTTCTTAGGTATCTTCC
AATCAGAGACATTGTGAGACAGTAAAGCAGTAGTTTGCGCTAGAAATATCTTGTAGTCCC
TCTTTTATATTCGTAGTATGTTATATAGATTACAATCTAGACAATACGAAGGAACGATCC
CGCGTCAGCAGATGTCACAATTTGATTATTTCATTGTCAC
Chr coordinates Chr II from 533549-533235
w3c xhtml validator w3c css validator