Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ICS2
Systematic Name YBR157C
Strain S288c
Description Protein of unknown function; null mutation does not confer any obvious defects in growth, spore germination, viability, or carbohydrate utilization
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ICS2 YBR157C
CGAAGCTTCCGCAATTCTCACACACCAAAAAATGAGTTACCGGCCGTCTCTTCTTTTGCC
CCTCGCATATAATGGGATTGCGAACGGAGAACGACAGCAATATAACAAGCGTACGTGATC
CCTTTCATTCTGTTATATTCGAGAATAGTTGTTGACAGTGGAGATAACTCCGAAAATATC
ATGAAAAAGAGGGTTATTTCCGTTCGTCGGGACATTGCTGTAGAGCTCTTCAATGGCCAC
AACTTGGGAGCGTTAATATGCAATCAAGTTGTAGGGAAGATTATATCTCTCCAGGGATTA
TTACCTGGGACACAGAGCTCTTTTCCTTATCTCATCTCACGCATCTAGACCCTGCTAGCC
GTCGTTTCTTATTTGAAGCGTTAATCACCCTCACTTTTCGTCCGTAGCACGTAAAAAAGA
AAAATAGGGTACCGTTTACCTGTCGTTAATATGCAAGTCATTAACAATCCAGCCCAGTAC
TTTATTTGCTATGGCACGGCATAGGCGCAGGGAGTTCACGATTTGGTCATCAATGATTAT
CACGATATGGGGGTCCTTATGATCTTGATGTTCTTTCAACTGCTCTTTGTTTCTTTTTTT
TTTGTACGACAGTTTATGTGTTAAAGAACACATCCACTCCAATTTTGGGTCGTTTATACT
TTTGTTTCGCTAATCTTAAGCCAACCTTGAGTTTATACCTAATTATATGCCACGTTAATG
CACAAAACCCCTCGTAATAAACTTTCCTTGGAAGACTTTCTTTTTCTATTCGACGCATTT
GGTTACATATCTGTTGGGAAAGAGCCCTTCGACTGCAAGTCCGGCATCAAGAAAGCTTGA
CATCCAAAGAAGCATTTAAGTATAAATAAATGAGACCCATTCTATCTTCTCAAATAAATC
TTTTACAAATATGTGAACGTCAAAGCGCATACTTAATAAAAATTTATACTCTACACCACC
TTCGTTATTACTTCACTGAAGTTTCCCTTTCCAGCAAGAT
Chr coordinates Chr II from 554310-553543
w3c xhtml validator w3c css validator